Busch Lab

ZMP

mmp16b

Ensembl ID:
ENSDARG00000058876
ZFIN ID:
ZDB-GENE-061009-22
Description:
Novel protein similar to vertebrate matrix metallopeptidase 16 (Membrane-inserted) (MMP16) [Source:U
Human Orthologue:
MMP16
Human Description:
matrix metallopeptidase 16 (membrane-inserted) [Source:HGNC Symbol;Acc:7162]
Mouse Orthologue:
Mmp16
Mouse Description:
matrix metallopeptidase 16 Gene [Source:MGI Symbol;Acc:MGI:1276107]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31251 Nonsense Available for shipment Available now
sa6824 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5714
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081833 Nonsense 154 613 4 10
ENSDART00000146861 Nonsense 154 618 4 10
Genomic Location (Zv9):
Chromosome 2 (position 4139324)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 3813850
GRCz11 2 3645029
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGGGAAATCARGAAACCCACGATGCGATCCGGCGGGCGTTTGACGTGT[G/A]GCAGGGAGTGACGCCGCTGCGCTTCGARGCCGTGCCCTTCCGTGACCTGG
Long Flanking Sequence:
TTATTAAATGAGTTATTAAAACTATTATGTTTAGAAATGTGTTGAAAAAATCTCTCTGTTAAACAGAAAATGAGGAAAAAATGAAACAGGGTATTAGTTAAACAGGGCTAATAATTTAGGAGGGCTAATAATTATGACTTTAACTGTATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAAATGTATATTTATGTATTCTCAGCCACACTAAAAGAAAAATATACTGTGAAAAAAATCATTGCTCTGTTAAACATCACTTGGGAAATATTTGAAAAAGTATTTATTTTGTCTTCAACTGTAACTGTAGTCTTTTTTCCTCAAGACGAAACTCCACAGCTATTTAGTTTTTTTCATCTGTTTATTATTGTATGTTTCAGCATTAAAAACGTCACTCCTAAAGTGGGAAATCAAGAAACCCACGATGCGATCCGGCGGGCGTTTGACGTGT[G/A]GCAGGGAGTGACGCCGCTGCGCTTCGAGGCCGTGCCCTTCCGTGACCTGGACAGCGGCAAGCGGGACGTGGACATCACCATCATCTTCGCCTCGGGTTTCCACGGCGACAGCTCTCCTTTTGACGGAGAGGGAGGATTCCTGGCTCATGCCTATTTCCCAGGGCCGGGCATCGGGGGCGACACACACTTCGACTCGGATGAACCCTGGACGCTGGGCAACCCAAACCATGATGGTGAGAGAACGGCAGGTTAGGCCACATTTTCAATCTCCACAATTAATGAATGAATGAAGTTGCAGTTTTGTGGCAGGGCAGAGCCAAGTGGTGCATGACATCTGGGTAGGGAGGCACAAACTGTTTATAAGTCCTTGCTTTAACTAGAATGCAAGGTCCACACTTAGAGGCTTAGTAACTTGTAGTACTATGTAACTAAATTTCTTCTTAATTCGGTTGCACCACGTGTTGAATGACGTAATATCCAATCAGAAGCATTTTAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31251
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081833 Nonsense 469 613 9 10
ENSDART00000146861 Nonsense 474 618 9 10
Genomic Location (Zv9):
Chromosome 2 (position 4127826)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 3802352
GRCz11 2 3633531
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGGTACTGGAGGTACAATGAGGATATGAGGACGATGGACCCTGGATA[T/A]CCACAACCTATTACTGTGTGGAAAGGCATCCCAGACTCTCCACAGGGAGC
Long Flanking Sequence:
TTCAGGATCCCGCGACACATTGCCGTTGTAGTTCTCAGTGTGTAGGTGGTTTTCTACTTGCATGTGTTTTCATGCTTTTTGAGCTCTCTCAACCACTGTAGTAAACAGCAATTGTTCTCAGTTCTGTTTATTAGTATATACTGTGTAACGCATCTATTTAATCTTTTAAAAATGTCTCTGTATTTCTCAAGGCAACCGGTTCTGGGTGTTTAAGGATACAACTCTGCAGCCCACATATCCTCAGGACATTTCTCTTTTTGGCAGTGGAATGCCCACGCAGAGCATCGAAACAGCTGTTTGGTGGGAAGACGTGGCCAAAACCTACTTCTTCAAAGGGGATAGGTCAGTTTTACAGCTCCCTGTTTACAGCGTGAGATGGGACACAGTGGATGCCGAATTCACTGGCGTATTTCATAGCATCTGTTAGAACTGTCTGCCTTTGTTTGCTGTTACAGGTACTGGAGGTACAATGAGGATATGAGGACGATGGACCCTGGATA[T/A]CCACAACCTATTACTGTGTGGAAAGGCATCCCAGACTCTCCACAGGGAGCATTCGTGGACAAAGCCAATGGTATGACATTAAAAAGACCCTGACTAACATTATTATTATATAGTCATTGAGTTACACAGTACTCACAGGTATTATTCCAAATTTCAGAATTAAATACAGCTACTGTCAAGCTACTGAAAAAATGTTGCTACTATAAGAGCTCCTTCTAGCTAGCTACTCCCCAACACTGCAACTCTTTCCATCCCAAAATCTCCTCACAGGTGCAGGGTTTGAGTAATTGGTTCTTGAGGAGAAATATCAGGGTTTCAGCTGAAAAGCTCAAGTTTCTCTGAAGCTCAGTGTGTTCTGGAGCTGCTGATCTCTGAGCTCCTTCACTGATAATTGGCCTCTGTGTGGTTTCTCTTAAAATCTCTCGGCCCGTGTAGATTTTCAGAAAGACAACTGGGCTGCAGTTTGGTCATTTTTAACATCTACATTCACATCAATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6824
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081833 Nonsense 476 613 9 10
ENSDART00000146861 Nonsense 481 618 9 10
Genomic Location (Zv9):
Chromosome 2 (position 4127806)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 3802332
GRCz11 2 3633511
KASP Assay ID:
554-4201.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGGATATGAGGACGATGGACCCTGGATATCCACAACCTATTACTGTGT[G/A]GAAAGGCATCCCAGACTCTCCACAGGGAGCATTCGTGGAYAAAGCCAATG
Long Flanking Sequence:
TGCCGTTGTAGTTCTCAGTGTGTAGGTGGTTTTCTACTTGCATGTGTTTTCATGCTTTTTGAGCTCTCTCAACCACTGTAGTAAACAGCAATTGTTCTCAGTTCTGTTTATTAGTATATACTGTGTAACGCATCTATTTAATCTTTTAAAAATGTCTCTGTATTTCTCAAGGCAACCGGTTCTGGGTGTTTAAGGATACAACTCTGCAGCCCACATATCCTCAGGACATTTCTCTTTTTGGCAGTGGAATGCCCACGCAGAGCATCGAAACAGCTGTTTGGTGGGAAGACGTGGCCAAAACCTACTTCTTCAAAGGGGATAGGTCAGTTTTACAGCTCCCTGTTTACAGCGTGAGATGGGACACAGTGGATGCCGAATTCACTGGCGTATTTCATAGCATCTGTTAGAACTGTCTGCCTTTGTTTGCTGTTACAGGTACTGGAGGTACAATGAGGATATGAGGACGATGGACCCTGGATATCCACAACCTATTACTGTGT[G/A]GAAAGGCATCCCAGACTCTCCACAGGGAGCATTCGTGGACAAAGCCAATGGTATGACATTAAAAAGACCCTGACTAACATTATTATTATATAGTCATTGAGTTACACAGTACTCACAGGTATTATTCCAAATTTCAGAATTAAATACAGCTACTGTCAAGCTACTGAAAAAATGTTGCTACTATAAGAGCTCCTTCTAGCTAGCTACTCCCCAACACTGCAACTCTTTCCATCCCAAAATCTCCTCACAGGTGCAGGGTTTGAGTAATTGGTTCTTGAGGAGAAATATCAGGGTTTCAGCTGAAAAGCTCAAGTTTCTCTGAAGCTCAGTGTGTTCTGGAGCTGCTGATCTCTGAGCTCCTTCACTGATAATTGGCCTCTGTGTGGTTTCTCTTAAAATCTCTCGGCCCGTGTAGATTTTCAGAAAGACAACTGGGCTGCAGTTTGGTCATTTTTAACATCTACATTCACATCAATATTAACTTGAAACACTGGGTCTCA
Associated Phenotype:
Not determined