Busch Lab

ZMP

zgc:110020

Ensembl ID:
ENSDARG00000058865
ZFIN ID:
ZDB-GENE-050522-402
Description:
endonuclease G, mitochondrial [Source:RefSeq peptide;Acc:NP_001019385]
Human Orthologue:
ENDOG
Human Description:
endonuclease G [Source:HGNC Symbol;Acc:3346]
Mouse Orthologue:
Endog
Mouse Description:
endonuclease G Gene [Source:MGI Symbol;Acc:MGI:1261433]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11931 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18910
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081819 Essential Splice Site 178 306 1 3
ENSDART00000081819 Essential Splice Site 178 306 1 3
Genomic Location (Zv9):
Chromosome 8 (position 12636279)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12081042
GRCz11 8 12118747
KASP Assay ID:
2260-0237.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAGAAAGCCATGGATGAAACATTTTACCTGAGCAATGTGTCTCCACAG[G/A]TGAACTGGAGCTGATCCTACCTTATAACAATTCATTTCAAGTTTATTTGT
Long Flanking Sequence:
CCGGTTTGTCACTGACAGCTGGCATTGGCATCGGTGCCACACTGACAGCAGCGGGTGACAGGCGTAATAACAACAGGAAAGCGAGTTTGCTGGATCGCGTGCCGGTCATCCCGATACCAAGCGTCGACGCGGCGTCAGAGATCAGCCCGTACCAGCCGGGACAGGTCTCTGTAAACCGGTCTACAGCTGCGATGAAATACGGCTTTCCTTCCCTGTCCAACATCAAAAGCAGAGAGTCTTACGTGACCTCCTACGACCCTAGAAACAGGACGGCAGCCTGGGTCATCGAGCAGCTGAACGCAGAGACGGTCACCGGAAGCTCGGACAGAAAGTACTGCGAGTTCAAAGAGGACGAGTCGGTTCATGTTTACCACAGGTCCAGCAATGCGGATTATAAGGGGAGTGGATTTGACAGGGGTCACTTGGCAGCAGCAGCCAATCACAAGTGGAGCCAGAAAGCCATGGATGAAACATTTTACCTGAGCAATGTGTCTCCACAG[G/A]TGAACTGGAGCTGATCCTACCTTATAACAATTCATTTCAAGTTTATTTGTATAGCGCTTTTCACAATATTTACCGTTCCAAAAGGTGCACGTTATTACATTACAGTCAATATCAGAACAGTATATAAAAATAAGCAGCAGATATACAATGTAGTGTATTGGGGTAAAGTTGGTTATATATTGGCACATTTATAATGTTATAATTTAATGGACCTATAATTAAGACTTTCTCATTAATAATAAAATTTCCAGAAAAGTATTCCTTGCAAATGGTAAATAGTGAAATCATACTAGCAGCCAATGACTATCAAATTACAACATTGATCACAGTCAATGAAAATAGAGCTAATGTTGTTTTGAAGTCATATTTACATGCCATTTCAGAACGAATATTCAAAGTAGCGTAATTAAGAATATAGAGACCTTGTCACGAGTTGTCACTGTTAAAAAAATACAAGAATGTGTGAATGTAAAAACAACTTTACCTCAATATAGTGTCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3686
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081819 Essential Splice Site 178 306 1 3
ENSDART00000081819 Essential Splice Site 178 306 1 3
Genomic Location (Zv9):
Chromosome 8 (position 12636279)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12081042
GRCz11 8 12118747
KASP Assay ID:
2260-0237.1 (used for ordering genotyping assays)
KASP Sequence:
GCCAGAAAGCCATGGATGAAACMTTTTACCTGAGCAATGTGTCTCCACAG[G/A]TGAACTGGAGCTGATCCTACCTTATAACAATTCATTTCAAGTTTATTTGT
Long Flanking Sequence:
CCGGTTTGTCACTGACAGCTGGCATTGGCATCGGTGCCACACTGACAGCAGCGGGTGACAGGCGTAATAACAACAGGAAAGCGAGTTTGCTGGATCGCGTGCCGGTCATCCCGATACCAAGCGTCGACGCGGCGTCAGAGATCAGCCCGTACCAGCCGGGACAGGTCTCTGTAAACCGGTCTACAGCTGCGATGAAATACGGCTTTCCTTCCCTGTCCAACATCAAAAGCAGAGAGTCTTACGTGACCTCCTACGACCCTAGAAACAGGACGGCAGCCTGGGTCATCGAGCAGCTGAACGCAGAGACGGTCACCGGAAGCTCGGACAGAAAGTACTGCGAGTTCAAAGAGGACGAGTCGGTTCATGTTTACCACAGGTCCAGCAATGCGGATTATAAGGGGAGTGGATTTGACAGGGGTCACTTGGCAGCAGCAGCCAATCACAAGTGGAGCCAGAAAGCCATGGATGAAACATTTTACCTGAGCAATGTGTCTCCACAG[G/A]TGAACTGGAGCTGATCCTACCTTATAACAATTCATTTCAAGTTTATTTGTATAGCGCTTTTCACAATATTTACCGTTCCAAAAGGTGCACGTTATTACATTACAGTCAATATCAGAACAGTATATAAAAATAAGCAGCAGATATACAATGTAGTGTATTGGGGTAAAGTTGGTTATATATTGGCACATTTATAATGTTATAATTTAATGGACCTATAATTAAGACTTTCTCATTAATAATAAAATTTCCAGAAAAGTATTCCTTGCAAATGGTAAATAGTGAAATCATACTAGCAGCCAATGACTATCAAATTACAACATTGATCACAGTCAATGAAAATAGAGCTAATGTTGTTTTGAAGTCATATTTACATGCCATTTCAGAACGAATATTCAAAGTAGCGTAATTAAGAATATAGAGACCTTGTCACGAGTTGTCACTGTTAAAAAAATACAAGAATGTGTGAATGTAAAAACAACTTTACCTCAATATAGTGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11931
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081819 Nonsense 301 306 3 3
Genomic Location (Zv9):
Chromosome 8 (position 12639428)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12084191
GRCz11 8 12121896
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTCAGGACTGCTGTTCGTACCAAACATCATGAAGAGGACCAGCAGTYTG[A/T]AAGCCATAACAGCAGGATGAGTTTACAGTCAATGCTGAGGGYGAAAGTAA
Long Flanking Sequence:
CTGGTAAATTTACAGTAAACACCACTTAGAGGCCGAGTCGAGTCAAGCAGAGTTTCACTTTCAGTGTAAAGCGTCCTGGTGTGTTTGAGCCTGAAGTCTACCGTTACTTCCAGTTCACAAGAACCTTATATTAGAAGTTCTAGATATTTCAAAATAGCAAATGCATCTCAAAACTCAAGATCTTAAAACATTTGAAAATCTTTGAGGGATGAAAAGTGAAATCTTTTTTTCTCTGCACCTACAGACAGGAAGCTGATGGGAAGATGTACGTGAAATATCAGGTTTTGGGAAAGAATCATGTAGCGGTGCCGACTCACTTCTTTAAGGTGGTGATTCTGGAGAAGCCGAGAGGAGATGTGGAGCTGCGCTCCTATGTGATGCCCAACATGCCGGTCGATGAGAAGATTCCACTGGAGCGCTTCCTGGTTCCTATTGAGAGCATTGAGAGAGCGTCAGGACTGCTGTTCGTACCAAACATCATGAAGAGGACCAGCAGTCTG[A/T]AAGCCATAACAGCAGGATGAGTTTACAGTCAATGCTGAGGGCGAAAGTAAAATCCATCAAAAATTCATAACAAAAGTTTTAAGGAAAACTACTGAGAAAACACATAGAAGTCAATGTATAGTGATAATGACTGTCATATCACTGTCTGATGTTGTATTGTTTAGTAGAGATTTTGTATTATTACTGTTGTTAGATGTCAGCCATTAACAGGGATTTTATAATATAACAATTAATTTATGCCGAGCCAAAACTGTACAGAAGTAGATTTTAATACAGATAGTGATATTTGAATCTGTACTACTAGAAATAAAAACTGTGCAATCTTTAAATCACATGAGTTTGCTTTTATTTAGCTTTGGTGTCTCTCAATAAAGCAATGCTATTCACAAACGATATCAGTAACTGTATATTTTTCATTTCTTTGCACAAATTTGTGCTCTCATCTTTTTATTAGCATACTTGCAACTTAAAATTTTATGCATTCATGACTGCCATTGCAA
Associated Phenotype:
Not determined