Busch Lab

ZMP

SUSD1 (2 of 2)

Ensembl ID:
ENSDARG00000058839
Description:
sushi domain containing 1 [Source:HGNC Symbol;Acc:25413]
Human Orthologue:
SUSD1
Human Description:
sushi domain containing 1 [Source:HGNC Symbol;Acc:25413]
Mouse Orthologue:
Susd1
Mouse Description:
sushi domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3651543]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26405
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081769 None None 670 None 14
ENSDART00000081772 Essential Splice Site 204 683 4 16
Genomic Location (Zv9):
Chromosome 5 (position 9709313)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8749048
GRCz11 5 9253686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTGCGGCCTGGATGGAAAATGGCAGGGGCCCAGTCTGGACTGTGAAGG[T/G]AATATTTACATCTATACACTCAAATAACATTGCCATGACTCATGTTACAG
Long Flanking Sequence:
GACATTTGAAGGCTTAACTAGGTTAACTAGGCAGGCTAGGGTAATTAGGCAAGTCATTGTATATCAGTGGTTTGTTCTGTAGACTATCGGAACAAAATATAGCTTAAAGGGGCTAATAATATTGTCCTTATATTTCCTTTATATTTCCTTATTATTAATATTTCCTTGCTCTATTCATCAAACATCATTTGGGAAATATTTAAAAACGCAGAAAAATTAAAAGGGGGGCTAATAATTCTGACTTCAACTGTATAAGCTGATGTTATATTCTGTCTGAGTAATGGATCTTTATACTATTATTGTACTTTGTCTGCAGTGATTGACTGTGGGTCTCCTCCAGCCGTCCTGCATGCTGATCTGCTCTCCTCCACAGTCAACACACACTACAGTACTGAGCTCCAGTACGGCTGCAGAGACGGCTTTCAGTGGAGGAGAGGACTCAACTCATCTGTTTGCGGCCTGGATGGAAAATGGCAGGGGCCCAGTCTGGACTGTGAAGG[T/G]AATATTTACATCTATACACTCAAATAACATTGCCATGACTCATGTTACAGTACAGTAAGAAGATATTTTTAAGAATTTTGAACAAATAACAGCCACTGACATCTATATTAGCCAAATGGGTCACCGAGTCTGTGACGTCATCGACATTTGCTTTAAGATTTAAAGGGCTAGCATTGCACCAGACCCCCTTAGGTGGTGTCGTTTGAAAGTGTAGAACCTATATTTTATGCACATATGCATCACCTTGGTTTTTATCCTACTGTGCAAAAGTTATTTACACTTAAATACACAGTATTTTGGATACCCGAGCTGGTTATTTTACAATGGTTCGTTTTCATATTTTTCATATGACACATGTACGAGTTATAGCTCAAATGAAAGCTCTTGCCGGTGCTCATTCAGTTCTAGCGTTCTTTTTACTGAATTATATTCACATATCAAACAGTTGTTGAATGAATTGTGGTGTTTCCATGGCGCAGAAGTGAAAACAATACATTTAT
Associated Phenotype:
Not determined