Busch Lab

ZMP

sema5a

Ensembl ID:
ENSDARG00000058821
ZFIN ID:
ZDB-GENE-030131-8969
Description:
Semaphorin 5a [Source:UniProtKB/TrEMBL;Acc:B6E511]
Human Orthologue:
SEMA5A
Human Description:
sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and sh
Mouse Orthologue:
Sema5a
Mouse Description:
sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and sh

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa37852 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32482 Essential Splice Site Available for shipment Available now
sa37853 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24468 Nonsense Available for shipment Available now
sa37854 Nonsense Mutation detected in F1 DNA Not yet available
sa9240 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37852
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Essential Splice Site 152 1078 5 21
Genomic Location (Zv9):
Chromosome 24 (position 17112112)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16418588
GRCz11 24 16563007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTACCTGCGGAACAAATGCATTCACTCCTATTTGCACCAATCGCACGG[T/C]AAGTAAACGCATCAATGCACGTAATATAATGCAGAGGTTTCCTGGCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32482
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Essential Splice Site 224 1078 6 21
Genomic Location (Zv9):
Chromosome 24 (position 17116559)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16423035
GRCz11 24 16567454
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCTTCCACCTCTGCGTACTGCTCAGTACAACTCCAAATGGCTCAATGG[T/G]AGGCTTAAAATATGAATGAAAGATTGAATTGAATTGAATTGAATTGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37853
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Essential Splice Site 699 1078 14 21
Genomic Location (Zv9):
Chromosome 24 (position 17180091)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16486567
GRCz11 24 16630986
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGGCGAAGAACGTGTGAGAATGGAAATGAATGCCCTGGATGCAGCACT[G/T]TATGTAACAATAATATTAATACTAAGTTTATTTTTAAATGAGTATCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24468
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Nonsense 739 1078 15 21
Genomic Location (Zv9):
Chromosome 24 (position 17195799)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16502275
GRCz11 24 16646694
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGTGAATATCTCAGACAATGGTGGCCACTACGAGCAGCGCTTCAGATA[C/A]ACCTGTAAAGCTCGAGTCCCAGAGCCCGGCCTGCTGGAAGTTGGACGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4284
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Essential Splice Site 775 1078 16 21
Genomic Location (Zv9):
Chromosome 24 (position 17219530)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16526006
GRCz11 24 16670425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACCACCACTAACAAGGTTCATACTAACTGGTTGAGTCTTGTGTGTTTC[A/T]GGAGATTTGCTGCGTTCTGGACGTATCACTGGATTGACARTAAATGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37854
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Nonsense 855 1078 17 21
Genomic Location (Zv9):
Chromosome 24 (position 17234127)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16540603
GRCz11 24 16685022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTTTTCCTTATCTTTCAGTGGACGGGAGCTGGTCGTGCTGGTCACCTT[G/A]GTCGAAATGCTCAGTGACATGCGGCGGAGGCCATTACATGCGCACACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9240
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Essential Splice Site 902 1078 17 21
Genomic Location (Zv9):
Chromosome 24 (position 17234269)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16540745
GRCz11 24 16685164
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGGTTTGYATACTGAAGAGGCCCTCTGCAACATCCAGCCCTGTCCTGG[T/A]ATGCACACACATTTGATTATTTTTAWCTGGAATGATGGTACTGATTAAAA
Associated Phenotype:
Not determined