Busch Lab

ZMP

bin1

Ensembl ID:
ENSDARG00000058820
ZFIN ID:
ZDB-GENE-030425-1
Description:
bridging integrator 1 [Source:RefSeq peptide;Acc:NP_001004602]
Human Orthologue:
BIN1
Human Description:
bridging integrator 1 [Source:HGNC Symbol;Acc:1052]
Mouse Orthologue:
Bin1
Mouse Description:
bridging integrator 1 Gene [Source:MGI Symbol;Acc:MGI:108092]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9213 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33802 Nonsense Mutation detected in F1 DNA Not yet available
sa40630 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9213
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081761 Essential Splice Site 28 364 2 14
Genomic Location (Zv9):
Chromosome 6 (position 6945157)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6871173
GRCz11 6 7028342
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATTYGCGAATCATATGCAGAGCGTCATTTCTTTTGCTTTATTTTCCTGT[A/G]GGTGATGCAGAAACTGGGAAAGGCGGATGAAACCAAAGACACAGCCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33802
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081761 Nonsense 56 364 3 14
Genomic Location (Zv9):
Chromosome 6 (position 6944958)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6870974
GRCz11 6 7028143
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAATATCTAGTGATGGTTTCTTCTTTGACTCCTCTCTATTCACAGAAC[G/T]AGGGCACCAAACTGCAGAAAGACTTGAAAGCGTATTTGCTGGCAGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40630
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081761 Nonsense 346 364 14 14
Genomic Location (Zv9):
Chromosome 6 (position 6916816)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6842832
GRCz11 6 7000001
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTGCAGGATGATGGCTGGTTAATGGGTGTAAAAGAGTCCCACTGGCTT[C/T]AGAACAAAAACCTCCTAGCAAAAGGAGTCTTCCCTGAAAACTTCACCCAG
Associated Phenotype:
Not determined