Busch Lab

ZMP

rev3l

Ensembl ID:
ENSDARG00000058801
ZFIN ID:
ZDB-GENE-050302-55
Human Orthologues:
KIAA2022, REV3L
Human Descriptions:
KIAA2022 [Source:HGNC Symbol;Acc:29433]
REV3-like, catalytic subunit of DNA polymerase zeta (yeast) [Source:HGNC Symbol;Acc:9968]
Mouse Orthologues:
C77370, Rev3l
Mouse Descriptions:
REV3-like, catalytic subunit of DNA polymerase zeta RAD54 like (S. cerevisiae) Gene [Source:MGI Symb
expressed sequence C77370 Gene [Source:MGI Symbol;Acc:MGI:2148050]

Alleles

There are 13 alleles of this gene:

Allele Name Consequence Status Availability
sa25129 Nonsense Mutation detected in F1 DNA Not yet available
sa19224 Nonsense Mutation detected in F1 DNA Not yet available
sa11025 Nonsense Available for shipment Available now
sa32271 Nonsense Available for shipment Available now
sa36949 Nonsense Mutation detected in F1 DNA Not yet available
sa43372 Nonsense Mutation detected in F1 DNA Not yet available
sa32270 Essential Splice Site Available for shipment Available now
sa19223 Nonsense Mutation detected in F1 DNA Not yet available
sa11290 Nonsense Available for shipment Available now
sa44931 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36948 Essential Splice Site Available for shipment Available now
sa43371 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25129
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 377 2953 10 32
ENSDART00000136987 Nonsense 47 2623 2 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3420262)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3363916
GRCz11 20 3381417
KASP Assay ID:
554-7709.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTTCTTCTCATCATATAGATACAAAAAGGGACAGTAGAAAAGATGAC[G/T]AAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT
Long Flanking Sequence:
ACAAACGGTTGTGATGTTTTGTGGATGTTCCCAGCTATGCTGACCAAGTCTATTCAAAATCTAAGATTTCAAGGACAAACGTTAAATCTTTCGCTCACGAGTCTGCTGTTGTGAAGAAGCTCAGCAGCAGAGAGAAAACTAGCACTGTTTAGCAGCTGTTGAACTCGTGCTCTCACACAACAGTGAAAGGACGGCTCTGGCAACTCCCATTCATAGCAGTTCCTGTAGTTACTACTGATGTTTGAGGGAAGCACATTTATTTTGAACTATGATAAAAAATCTGACTGGAACTACCAGTACAGTTTAACAAATCCATTGCACACTCGCCAACCTATCAGAGTCAAGAACTTTAACAGACCATGGAATAATACAGTATATGTATGGAGTCTGTTTGAGACTGTACAGTGAAACTTACAATTGGTCTCTGACTGTATTGAAAATAATGACCTTGTTTTTCTTCTCATCATATAGATACAAAAAGGGACAGTAGAAAAGATGAC[G/T]AAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGTCAGTCTTTCCTCCAGCTCTCTCAGACATCCAGCCAATCAGCAATATTTGGTATGTGCATTGTTACAAGAAATATAACATTGATTTCCGAAAAAAAAGAAGCTAAAAGCGTTTACACTGTAGGATATTAATCAAGGTTTTAATACATTTTTGAGTAAAAAGGTGAAGTCTTAGTTAAAAGATTTGTTTTTCTTGAACTAAAATTGTGAGATGCAATGTGTTTACGTACGTTTTCATAATTTTAGTTTTTTCCTATTGTTTACTCTTTAGTTATATGCCCAGAATTACATTTTGTAGATGTAAAAAAAAAGAGTTTATTTGTAATGTATTTGATATTATACTGGAAAATAACAAAATGTTTTCTTTTTTGCATTTATGATTTTGTCAATTATAACCTTTGCTTATTCATAATATTTTTTGTATGTGTTCTGATATATGCTATTTAATACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19224
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235 None None 95 None 3
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3420211)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3363865
GRCz11 20 3381366
KASP Assay ID:
2261-3903.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT[C/T]AGTCTTTCCTCCAGCTCTCTCAGACATCCAGCCAATCAGCAATATTTGGT
Long Flanking Sequence:
ATTCAAAATCTAAGATTTCAAGGACAAACGTTAAATCTTTCGCTCACGAGTCTGCTGTTGTGAAGAAGCTCAGCAGCAGAGAGAAAACTAGCACTGTTTAGCAGCTGTTGAACTCGTGCTCTCACACAACAGTGAAAGGACGGCTCTGGCAACTCCCATTCATAGCAGTTCCTGTAGTTACTACTGATGTTTGAGGGAAGCACATTTATTTTGAACTATGATAAAAAATCTGACTGGAACTACCAGTACAGTTTAACAAATCCATTGCACACTCGCCAACCTATCAGAGTCAAGAACTTTAACAGACCATGGAATAATACAGTATATGTATGGAGTCTGTTTGAGACTGTACAGTGAAACTTACAATTGGTCTCTGACTGTATTGAAAATAATGACCTTGTTTTTCTTCTCATCATATAGATACAAAAAGGGACAGTAGAAAAGATGACGAAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT[C/T]AGTCTTTCCTCCAGCTCTCTCAGACATCCAGCCAATCAGCAATATTTGGTATGTGCATTGTTACAAGAAATATAACATTGATTTCCGAAAAAAAAGAAGCTAAAAGCGTTTACACTGTAGGATATTAATCAAGGTTTTAATACATTTTTGAGTAAAAAGGTGAAGTCTTAGTTAAAAGATTTGTTTTTCTTGAACTAAAATTGTGAGATGCAATGTGTTTACGTACGTTTTCATAATTTTAGTTTTTTCCTATTGTTTACTCTTTAGTTATATGCCCAGAATTACATTTTGTAGATGTAAAAAAAAAGAGTTTATTTGTAATGTATTTGATATTATACTGGAAAATAACAAAATGTTTTCTTTTTTGCATTTATGATTTTGTCAATTATAACCTTTGCTTATTCATAATATTTTTTGTATGTGTTCTGATATATGCTATTTAATACATTCAAGTTCATCCTAATAGTGTCGACTCTGTTCTAACAGACGGCAGTCAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11025
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235 None None 95 None 3
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3420211)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3363865
GRCz11 20 3381366
KASP Assay ID:
2261-3903.1 (used for ordering genotyping assays)
KASP Sequence:
AAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT[C/T]AGTCTKTCCTCCAGCTCTCTCAGACATCCAGCCAATCAGCAATATTTGGT
Long Flanking Sequence:
ATTCAAAATCTAAGATTTCAAGGACAAACGTTAAATCTTTCGCTCACGAGTCTGCTGTTGTGAAGAAGCTCAGCAGCAGAGAGAAAACTAGCACTGTTTAGCAGCTGTTGAACTCGTGCTCTCACACAACAGTGAAAGGACGGCTCTGGCAACTCCCATTCATAGCAGTTCCTGTAGTTACTACTGATGTTTGAGGGAAGCACATTTATTTTGAACTATGATAAAAAATCTGACTGGAACTACCAGTACAGTTTAACAAATCCATTGCACACTCGCCAACCTATCAGAGTCAAGAACTTTAACAGACCATGGAATAATACAGTATATGTATGGAGTCTGTTTGAGACTGTACAGTGAAACTTACAATTGGTCTCTGACTGTATTGAAAATAATGACCTTGTTTTTCTTCTCATCATATAGATACAAAAAGGGACAGTAGAAAAGATGACGAAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT[C/T]AGTCTTTCCTCCAGCTCTCTCAGACATCCAGCCAATCAGCAATATTTGGTATGTGCATTGTTACAAGAAATATAACATTGATTTCCGAAAAAAAAGAAGCTAAAAGCGTTTACACTGTAGGATATTAATCAAGGTTTTAATACATTTTTGAGTAAAAAGGTGAAGTCTTAGTTAAAAGATTTGTTTTTCTTGAACTAAAATTGTGAGATGCAATGTGTTTACGTACGTTTTCATAATTTTAGTTTTTTCCTATTGTTTACTCTTTAGTTATATGCCCAGAATTACATTTTGTAGATGTAAAAAAAAAGAGTTTATTTGTAATGTATTTGATATTATACTGGAAAATAACAAAATGTTTTCTTTTTTGCATTTATGATTTTGTCAATTATAACCTTTGCTTATTCATAATATTTTTTGTATGTGTTCTGATATATGCTATTTAATACATTCAAGTTCATCCTAATAGTGTCGACTCTGTTCTAACAGACGGCAGTCAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32271
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 976 2953 13 32
ENSDART00000136987 Nonsense 646 2623 5 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3417768)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3361422
GRCz11 20 3378923
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTCAGTTCTGATGAAACTCACACAGTTTTAACACCGGAAAAGCTTGCT[G/T]GATATGAACAGCTTGCTCCTCTCAAAAAATTCTGGCCCAAAATTCCAGAG
Long Flanking Sequence:
CATTAGATCAAAAACGGGAACTTCCTGTAAAGACACATTCTCCTACGAAAGAAGAACCTCCAGCCCTTCTTTCCATCACTCCAGGCTCTCACAATCAGAACGAAGTGAGCAAGGAGGTTGACATGGAAACTTCAGGATCGTTAATTGAGAGTTCGGGAAAGGGCGATTTTGCAGATATTCCAACAAACATCTCTTGTACCAAGGTGGCAAGTTTGCCAGGCAGCAAATATACCTTGCGGACCAAAAGAAAAAGGATTTATGAAAAAGGAGATCATCCAAGATCTGGTTCCTCCAAACAAGCCTCAGTACATCATGATGACCCTAAAGGAAGTGATCATGTCTTCAGTCAAAAAAAGAGGAAAGTGACTAAAAAAGAGCCACCGGTTATCATCAAATACATAATCATTAACAGATTTAAAGGTCAGAAGAACATGTTAGTAAAGATTTCTAAAGTCAGTTCTGATGAAACTCACACAGTTTTAACACCGGAAAAGCTTGCT[G/T]GATATGAACAGCTTGCTCCTCTCAAAAAATTCTGGCCCAAAATTCCAGAGTCTACAGCAGAGAAGTACCCGTCGCTTGAGCCAAAAGTAAAGAAATGTCCCAAACGGAAAGCGAAGATCAACCCAGTGGTAAAAAGGATGACCACCTTCCCAAAATCCAAGTGTCCACGAGTTGGCCAGACTAGAGGGGAAAGGCGTGCTAAAGCAATGTTGCCTGTGCAAACATTAGCCCCTCCATGGCCTTCCTATAATGATTTTACAGATGACACTTGTACAGAGTATTGCGATGTCATGATGAAGTTGGGTTACTTGTCAGAAAGAGCCCCCAGTCCTACTGACTCAACCCCACCTAGATGTTGGTCTCCTACAGAGCACTTGCATGGATCAAATTCAAATGATCATTTTATAAATCCTCATAATGATCCATGTCTAGGTTCTTCTTGTGAAGCCCTGACTCCAAAACCATCCCAAAGTGGTCTTTTGAATAGAAGCAGAATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36949
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 1208 2953 13 32
ENSDART00000136987 Nonsense 878 2623 5 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3417070)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3360724
GRCz11 20 3378225
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGAAAGGCCAATGTTTGTAGATGTCACATCTACTTCTCAGAAAGGATG[G/A]ATGCGCAATGAGAAGCAATTACTTCAAAGAAAGCAGGATCATGGCAAGGG
Long Flanking Sequence:
GCTAAAGCAATGTTGCCTGTGCAAACATTAGCCCCTCCATGGCCTTCCTATAATGATTTTACAGATGACACTTGTACAGAGTATTGCGATGTCATGATGAAGTTGGGTTACTTGTCAGAAAGAGCCCCCAGTCCTACTGACTCAACCCCACCTAGATGTTGGTCTCCTACAGAGCACTTGCATGGATCAAATTCAAATGATCATTTTATAAATCCTCATAATGATCCATGTCTAGGTTCTTCTTGTGAAGCCCTGACTCCAAAACCATCCCAAAGTGGTCTTTTGAATAGAAGCAGAATGCAGAGACCTAAGAAGACTTCTGGGACCAGCCAAAAAAGAAAATCGAATAGCTTAACAACAGCAACAAACAAGGGTTCTCTGAAAACTGAGGATTCTAAATGGAAAAGTATTCCAGCAGCTTCAAGGAAGCATAAGAAATATTGTGATGGAATTGAAAGGCCAATGTTTGTAGATGTCACATCTACTTCTCAGAAAGGATG[G/A]ATGCGCAATGAGAAGCAATTACTTCAAAGAAAGCAGGATCATGGCAAGGGAAGCAATAATTCACAGGGCCTGAATTCATCTGACAATTTACCTGTTACTCAATTATCTGATTATCTAACTCCTTTCCAATGTCCCAGTTTTCTAAAAAGCAACCCGGAGGACCTTGCTCTCGGTTGTTCAGACTCTAAAACTGAGGTTCATAGTTTCTTTGATTCTATTGCTTCAAATAACTCTCAGAAAGACTTACGAATTGCTCCCAATTCCACTATTGAAAAGTCTTTTAGTATTCTTTCCCAACCCACAAAGACTGTAGGACATCCATGTTCTGTCATTACATATGGAAGTTCTAATTCAAAATCCAAAAATACAAGTCAGGATGGGACTAAAACAAAAAACCATGATGTCATATCAGTGGTCTCTGGCCATGAAGAAAGATCTGGTACTGTACAGCAATCACAGTTACCCATAACATCGAGAAGGCCGCAAGCGAGAAAGAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43372
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 1428 2953 13 32
ENSDART00000136987 Nonsense 1098 2623 5 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3416412)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3360066
GRCz11 20 3377567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTAAGAATAGGGAAATGTGTGTTTTGAAGGAACTTCTCCAGAAGAGG[C/T]AGCTTAAGGAAGAACAGGAAGCAAATAAAAGTGATGGTTTGACTGAGGCG
Long Flanking Sequence:
AGGACCTTGCTCTCGGTTGTTCAGACTCTAAAACTGAGGTTCATAGTTTCTTTGATTCTATTGCTTCAAATAACTCTCAGAAAGACTTACGAATTGCTCCCAATTCCACTATTGAAAAGTCTTTTAGTATTCTTTCCCAACCCACAAAGACTGTAGGACATCCATGTTCTGTCATTACATATGGAAGTTCTAATTCAAAATCCAAAAATACAAGTCAGGATGGGACTAAAACAAAAAACCATGATGTCATATCAGTGGTCTCTGGCCATGAAGAAAGATCTGGTACTGTACAGCAATCACAGTTACCCATAACATCGAGAAGGCCGCAAGCGAGAAAGAAAGACACTGGGACAGCTTTATTGAAGCCTGTTGATTCTATATCTTCTCCTACTTCCTCTACTAAGAGTGCAGCTATATATGAATCAAACACAGATCTCACATTGTCCTCCGATTTTAAGAATAGGGAAATGTGTGTTTTGAAGGAACTTCTCCAGAAGAGG[C/T]AGCTTAAGGAAGAACAGGAAGCAAATAAAAGTGATGGTTTGACTGAGGCGGTTTCTTCCACCAGTCAAAATACTGATGTTGCCAAAAGGGCAAAATCTAAGAGAACTCTGTCATCACCATCAAGAAAACCAAGGGGTGCAAGAACAAAAGTGCAAACCAGATGTAAGAAAAATAAACAAGATGACCAGAGAAATGATTGTCTTTCCTCAGATGGCAGTCCTGTGTTTTTTTCTGATCCTGGCTTTGACAGCTGTTGCTCTGTTGAGGATAGCTTGTCCCCAGAACTTCCAGATAATTACAGATTTGATATCAATGTCATCGGCCAAACAGAGTTCTCCAGTCTTTATTCTGGTAACCAGTTTGTGTTAACTGACAAGATCTTGCCTCAGAAGTTCCTCAGTGATGTCAGTCAAGAGGCAGCGAATGCGCTGGTTGGGTTGGGGAACAGGACACAAAAGATGTTTGATGTTGATGATGACTTCAATCATGGAAACGATCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32270
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Essential Splice Site 1757 2953 13 32
ENSDART00000136987 Essential Splice Site 1427 2623 5 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3415422)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3359076
GRCz11 20 3376577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGGAACCATTCTACAGTGACCCGTCAGATGTGCCATTGAAGCCAAGG[T/C]AAGGTACACAAGTCTGTGTTGTAATTTTTTCTTGTTTAAAAGTTGCATTT
Long Flanking Sequence:
GAAACGATCGGAATAAATCTGGTGCTCTTAGTCCAGAATTGTTTGATAAGGTGTCTTGTGAAAATGGCAGAGTTTTTCCCAATAAGGTATCCCTGTCTCTGCTGGATTCAGAAAAGATCTTTAGCACTAATTGGGCTGGTTCTTTAGGTAAAATTCATGGCCTCAGCCACTTTCGGGACTTTCACTGTGAGAAGAGAGATGTGCTGCTTGACCCAGAGCCCAAATCCCCCATTATGTCAGCTTCTTTTGCTTACGGTGTTTCCCCAAATAGTGATCTCCTAGATGGCAGTTCACTAACACCGAGCAGTTCACCACGGTCAATCAACTCTCTGTCTCAGCTGAAGACTTCAAGGACTGGTGGAACTCGCATTCTCAAACCTTTGATGTCTCCACCTGCTCGAGAAGAAATCTTAGCTAATTTGATGGATCTGGACTTTTCAGAAGCTACAAAACAGGAACCATTCTACAGTGACCCGTCAGATGTGCCATTGAAGCCAAGG[T/C]AAGGTACACAAGTCTGTGTTGTAATTTTTTCTTGTTTAAAAGTTGCATTTGCGTGGTTTTGGATTCAAGTGTCTGTTTATCTGTGTATTTTCAAGTTGGACTATGAAATTATCAAATAAAATAATAAGTAAACAGTCACTGTTTTTTCAGGGAGGTTGGTGGACGAAAGTTGATTTTGGAAACCAGGCAGGCAAGCAGACTAGTTGAATTCCATGGGGACTTATCTCAAAATGGTTTGCAGTTTTGGAAAGTCGCATTTTCTGCAATGACAAATCAGGCCTCTGCTCCAACTCAAGGATGTAAATCCTCCAAACTGATCAAGAACCAAAGCCCATCTTCTGTCAGTGACCCAAAAGTTATCATCCTTCCCTGCAAGTGTGCCCCTAGCCGAGAGCAGGTGCAGCTTTGGGCGCAGGCCAAAAAACAGTATGAGTGCCTTCAGAGAGGTAGGATACAAATGGGTGGCCATGAGATTTCAGAGCTGAAGCAGAGTACATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19223
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235 None None 95 None 3
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3414992)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3358646
GRCz11 20 3376147
KASP Assay ID:
2261-3902.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCCTAGCCGAGAGCAGGTGCAGCTTTGGGCGCAGGCCAAAAAACAGTA[T/A]GAGTGCCTTCAGAGAGGTAGGATACAAATGGGTGGCCATGAGATTTCAGA
Long Flanking Sequence:
GGACTTTTCAGAAGCTACAAAACAGGAACCATTCTACAGTGACCCGTCAGATGTGCCATTGAAGCCAAGGTAAGGTACACAAGTCTGTGTTGTAATTTTTTCTTGTTTAAAAGTTGCATTTGCGTGGTTTTGGATTCAAGTGTCTGTTTATCTGTGTATTTTCAAGTTGGACTATGAAATTATCAAATAAAATAATAAGTAAACAGTCACTGTTTTTTCAGGGAGGTTGGTGGACGAAAGTTGATTTTGGAAACCAGGCAGGCAAGCAGACTAGTTGAATTCCATGGGGACTTATCTCAAAATGGTTTGCAGTTTTGGAAAGTCGCATTTTCTGCAATGACAAATCAGGCCTCTGCTCCAACTCAAGGATGTAAATCCTCCAAACTGATCAAGAACCAAAGCCCATCTTCTGTCAGTGACCCAAAAGTTATCATCCTTCCCTGCAAGTGTGCCCCTAGCCGAGAGCAGGTGCAGCTTTGGGCGCAGGCCAAAAAACAGTA[T/A]GAGTGCCTTCAGAGAGGTAGGATACAAATGGGTGGCCATGAGATTTCAGAGCTGAAGCAGAGTACATGTGACAGGAGCACAACTCAGAAGACCTCGAATTCGCTTTTCTCAGAGAATCATGATAAAAGGCCTGAAAAAAATTCAGAATCGCAACATAACAGTCGGAATGACTTCTGTTCACCCATCCATTTTTCACCAGTTAAAGCAGCTTCATCTGACAGTAGCCCTAGCAGTGTGAAATGTGTCCAGGACATTGACAAAACAAAAGATTGCCGGATTACTTCTCCTCCAAACTCACCTGAGATTTCTACATGGCAAGATAGCCCAGACGAGGTTGAGCAAGATGAGGATAAGGAGAATCTGACTGGGGGGTTGCAACCCCTCTCCATGGATCAAAATTTGAATGAGACGTTACTTGAAAATGCGGAGTCAAAAGATCACTTGAGTCCGTCATTTTTTGGAATTAAAGGCCTAGTTTCAGATGTCAGATGCTCGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11290
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235 None None 95 None 3
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3414992)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3358646
GRCz11 20 3376147
KASP Assay ID:
2261-3902.1 (used for ordering genotyping assays)
KASP Sequence:
GCCCCTAGCCGAGAGCAGGTGCAGCTTWGGGCGCAGGCCAAAAAACAGWA[T/A]GAGTGCCTTCAGAGAGGTAGGATACAAATGGGTGGCCATGWGATTTCAGA
Long Flanking Sequence:
GGACTTTTCAGAAGCTACAAAACAGGAACCATTCTACAGTGACCCGTCAGATGTGCCATTGAAGCCAAGGTAAGGTACACAAGTCTGTGTTGTAATTTTTTCTTGTTTAAAAGTTGCATTTGCGTGGTTTTGGATTCAAGTGTCTGTTTATCTGTGTATTTTCAAGTTGGACTATGAAATTATCAAATAAAATAATAAGTAAACAGTCACTGTTTTTTCAGGGAGGTTGGTGGACGAAAGTTGATTTTGGAAACCAGGCAGGCAAGCAGACTAGTTGAATTCCATGGGGACTTATCTCAAAATGGTTTGCAGTTTTGGAAAGTCGCATTTTCTGCAATGACAAATCAGGCCTCTGCTCCAACTCAAGGATGTAAATCCTCCAAACTGATCAAGAACCAAAGCCCATCTTCTGTCAGTGACCCAAAAGTTATCATCCTTCCCTGCAAGTGTGCCCCTAGCCGAGAGCAGGTGCAGCTTTGGGCGCAGGCCAAAAAACAGTA[T/A]GAGTGCCTTCAGAGAGGTAGGATACAAATGGGTGGCCATGAGATTTCAGAGCTGAAGCAGAGTACATGTGACAGGAGCACAACTCAGAAGACCTCGAATTCGCTTTTCTCAGAGAATCATGATAAAAGGCCTGAAAAAAATTCAGAATCGCAACATAACAGTCGGAATGACTTCTGTTCACCCATCCATTTTTCACCAGTTAAAGCAGCTTCATCTGACAGTAGCCCTAGCAGTGTGAAATGTGTCCAGGACATTGACAAAACAAAAGATTGCCGGATTACTTCTCCTCCAAACTCACCTGAGATTTCTACATGGCAAGATAGCCCAGACGAGGTTGAGCAAGATGAGGATAAGGAGAATCTGACTGGGGGGTTGCAACCCCTCTCCATGGATCAAAATTTGAATGAGACGTTACTTGAAAATGCGGAGTCAAAAGATCACTTGAGTCCGTCATTTTTTGGAATTAAAGGCCTAGTTTCAGATGTCAGATGCTCGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44931
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Essential Splice Site 2043 2953 14 32
ENSDART00000136987 Essential Splice Site 1713 2623 6 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3414413)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3358067
GRCz11 20 3375568
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGCACTGACGATGAAGCCTCTAGCTGCAGTCCAGTGCGACATGAAGG[T/C]ATAGCTTTATGTAACCTTTCTCAAATCTTTTCAACTACAGTTTGTTTAGC
Long Flanking Sequence:
ACAACTCAGAAGACCTCGAATTCGCTTTTCTCAGAGAATCATGATAAAAGGCCTGAAAAAAATTCAGAATCGCAACATAACAGTCGGAATGACTTCTGTTCACCCATCCATTTTTCACCAGTTAAAGCAGCTTCATCTGACAGTAGCCCTAGCAGTGTGAAATGTGTCCAGGACATTGACAAAACAAAAGATTGCCGGATTACTTCTCCTCCAAACTCACCTGAGATTTCTACATGGCAAGATAGCCCAGACGAGGTTGAGCAAGATGAGGATAAGGAGAATCTGACTGGGGGGTTGCAACCCCTCTCCATGGATCAAAATTTGAATGAGACGTTACTTGAAAATGCGGAGTCAAAAGATCACTTGAGTCCGTCATTTTTTGGAATTAAAGGCCTAGTTTCAGATGTCAGATGCTCGCACCTACTCCATAGTACACCTGTTCAAAGGAGAAACAGCACTGACGATGAAGCCTCTAGCTGCAGTCCAGTGCGACATGAAGG[T/C]ATAGCTTTATGTAACCTTTCTCAAATCTTTTCAACTACAGTTTGTTTAGCTTTATGAATAACTGGTTTCCACATGGTTTTATGTTTGTAGCCTCATAGAGTTGTTAAAGGGCACCTATGATTCGAAATCATCTTTTGGAAGCTGTTTGGACCACTGTCCCATAGGACAAGAAGTCTCCTAAATAAAAATTCTGACCTTTAAATCCCTGCATTTTTGAGGCACGGTGTAACGTGATGTAGGAGTGTGGTTTTCCCCATCCACTGAATTGATTGACAGCTGCATATTAACATGTCTCTTTAGTGACGCATATAATCATATCCATAAGGTAGGACTTGCAAAGAAACTGAGATTAAAAAAATCTGTTCAACTCTGTGATCAGCTGCACCTCAAGAAAGAGTTTTACAAGTTTAAAACGTTTTTAAAATGGTGCATGTTTGTAATAATGTAGAGAAAACTGTAAAATCGCTGTTAATCATGCTGGAATCACCACAGCTGCATAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7927
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Essential Splice Site 2179 2953 18 32
ENSDART00000136987 Essential Splice Site 1849 2623 10 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3408257)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3351911
GRCz11 20 3369412
KASP Assay ID:
2261-3901.1 (used for ordering genotyping assays)
KASP Sequence:
ATAATATTAAATGTGTCTGTTTCAACATTATAGCTTGTTGTATTTTTTCNNNA[G/A]CTTCCAGAAGTTCGACACCYTTTCTTTTTAGGTGYGGTGTGACAGGACTG
Long Flanking Sequence:
GCGTTTGTTGACTAACATTAACCAAATGCCAAGCAAGACGCATGCTTCCTGTTTATACTTGAAAGCGCATGCCCAGAGTGCGAGAATGGTCACGTGATATATGTTTTTGGTGGCGTAGTGTGGACTGATATATGATCAGAAACGCTAGTTGAACTGCAGATCGTTTTTTATCTAAAACGACGTTTTAAAACTAAAACGCACTTGTGTAAACGGGGCCTTAGTGATGGGTTTTAAACAATTGGTTACGCATGTGAAAGAGCACAGATTTGCTTGTGATTCAGGCATTAGTCAGCGGTTTCTCAAAACTCGTCATTGAGTCAAAATCAGGGCTAAAATCATGCAGTCTGAGCTCTGCATTAGGGGGTTTCATTCGTCTCGCTGAATGAGACATAAAGTTTGGTAAAAAGATTCAAACTTCTAATCACTATACAGTCTTGCGTGATGTTTTACATAATATTAAATGTGTCTGTTTCAACATTATAGCTTGTTGTATTTTTTCA[G/A]CTTCCAGAAGTTCGACACCTTTTCTTTTTAGGTGCGGTGTGACAGGACTGCCGGTGACCTACACCTGTGATGAGAAGGAGCTGTTTGAAGAGGTCTCTAACATAATTAGGAAGTAGGTTTTTTATTTTCCTTTTTTAATTACGCTGCTTTGTTTCTGTCGGTTATTCCTTCATGTTAATAATAGACAAGTTCTATTATCTCTACTATTCTAAATGATTAGAACGCTAGTATTTTCATCAACTAAAAATTATTCTGTTTTGATATTTATGTCAAAGCAGTTCACAGGGTATGCCACATTTCAGGGTAATGCTTATTAATTTAGTTTGAAGATCTTAATACAAAAGGATCTGCTATTTTGAAAAGTTTGGGTTGTTCAGATGTGACCATTACCCATATCTCCCAGCCTGACCAGCTAAAACCAGGCTGGAAATGGCTGGAAACTAGCCTGGAAATGGCCAAAACCCCTCTAAAACCAGCCTGGTTGACCAGCTAAAACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36948
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Essential Splice Site 2216 2953 18 32
ENSDART00000136987 Essential Splice Site 1886 2623 10 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3408144)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3351798
GRCz11 20 3369299
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGTGATGAGAAGGAGCTGTTTGAAGAGGTCTCTAACATAATTAGGAA[G/A]TAGGTTTTTTATTTTCCTTTTTTAATTACGCTGCTTTGTTTCTGTCGGTT
Long Flanking Sequence:
CGTAGTGTGGACTGATATATGATCAGAAACGCTAGTTGAACTGCAGATCGTTTTTTATCTAAAACGACGTTTTAAAACTAAAACGCACTTGTGTAAACGGGGCCTTAGTGATGGGTTTTAAACAATTGGTTACGCATGTGAAAGAGCACAGATTTGCTTGTGATTCAGGCATTAGTCAGCGGTTTCTCAAAACTCGTCATTGAGTCAAAATCAGGGCTAAAATCATGCAGTCTGAGCTCTGCATTAGGGGGTTTCATTCGTCTCGCTGAATGAGACATAAAGTTTGGTAAAAAGATTCAAACTTCTAATCACTATACAGTCTTGCGTGATGTTTTACATAATATTAAATGTGTCTGTTTCAACATTATAGCTTGTTGTATTTTTTCAGCTTCCAGAAGTTCGACACCTTTTCTTTTTAGGTGCGGTGTGACAGGACTGCCGGTGACCTACACCTGTGATGAGAAGGAGCTGTTTGAAGAGGTCTCTAACATAATTAGGAA[G/A]TAGGTTTTTTATTTTCCTTTTTTAATTACGCTGCTTTGTTTCTGTCGGTTATTCCTTCATGTTAATAATAGACAAGTTCTATTATCTCTACTATTCTAAATGATTAGAACGCTAGTATTTTCATCAACTAAAAATTATTCTGTTTTGATATTTATGTCAAAGCAGTTCACAGGGTATGCCACATTTCAGGGTAATGCTTATTAATTTAGTTTGAAGATCTTAATACAAAAGGATCTGCTATTTTGAAAAGTTTGGGTTGTTCAGATGTGACCATTACCCATATCTCCCAGCCTGACCAGCTAAAACCAGGCTGGAAATGGCTGGAAACTAGCCTGGAAATGGCCAAAACCCCTCTAAAACCAGCCTGGTTGACCAGCTAAAACCAGCCAACCAGCCTAGGCTGGTTTAAGATGTTTTTTTCAGTAGGGTAATGTATCTCAATACATAAAAGGCTTTCTTTTCTTACTGCACACTCATTCGTTCATTAATTTATTCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43371
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 2237 2953 19 32
ENSDART00000136987 Nonsense 1907 2623 11 24
ENSDART00000148235 None None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3407110)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3350764
GRCz11 20 3368265
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATTCTTGTTGGCTATGAGGTCCAGATGCATTCTTGGGGCTATTTACTA[C/T]AGCGTGCTTCAACGCTTGGTGTGAACTTGTGCCAACAACTATCCCGTGTG
Long Flanking Sequence:
TGGTCATCACAACGGAATGAACCGACAACTTATCCAGCATATGTTTTACGCAGCTGCAACCCATCTCTGAGAAACATCCATTTACACTCATTCACACTCATACACTACGGAATTGGACTGTGGGGTAAACCAGAGCACCGGAAGGAAACTAACGCAAGCGCGGGGAGAACATGCAAACTCCACACAGAAATGCCAACTGACTCAGCTGAGGCTCGAACCAGCAACCTTCTTGCTGCAAGGCTACAGCACTACCTACTGCATCACCGCGTCGACCATACTGCACACTTATCATTTGTTAGATAGTTCTTTTTTTTTTACTATTATAACTTTTATCATTGTATGTGATTTTACACCTGAAACAGTCAATATGGCTGTCCAGAAAGCATGCTAGTTTGTGAAGGTGAGTACTCCTGACTTGTCATAACAATCACCTTTTCAGGTATGACCCAGACATTCTTGTTGGCTATGAGGTCCAGATGCATTCTTGGGGCTATTTACTA[C/T]AGCGTGCTTCAACGCTTGGTGTGAACTTGTGCCAACAACTATCCCGTGTGCCAGGTAAGGTTATAGTTCACTTTCTTGCCCTGTACATTCTGACAATAGTTTCAAGTTGCAGTTGCAGATTTGGGAAATGCTAACTTTAGCCTGATAACATTGAAAACATGCATCCATCCCGACATTCAAACTGTTTTCCAAAACCACAATATATAAACATCTACTCAGTGTTGGGCAGTAGCGTCGCCCCAAGTACTGATGCTACTAGTTTAACCACATTTCTCAGTAGTGTGGTGGTAGCATCACTGCTTTATAAATCAAATAGCTTTTCAGTAGCAAAGCTATTTCTTTAAGGCTGATTTATACTTCTGCGTCAAACGCCGGCGTATGCTACGGCGCTGATGCATAGCCCTTCGCCGTGACCGTCGGCGTCGCTGACGTGCACCTCTCAAAAAATGTAACTACACGTCGCAACGACGCGTTGCGTAAGCTCTGTGATTGGTCGGCTT
Associated Phenotype:
Not determined