Busch Lab

ZMP

zgc:175176

Ensembl ID:
ENSDARG00000058775
ZFIN ID:
ZDB-GENE-080204-92
Description:
hypothetical protein LOC797890 [Source:RefSeq peptide;Acc:NP_001107932]
Human Orthologue:
SLC22A3
Human Description:
solute carrier family 22 (extraneuronal monoamine transporter), member 3 [Source:HGNC Symbol;Acc:109
Mouse Orthologue:
Slc22a3
Mouse Description:
solute carrier family 22 (organic cation transporter), member 3 Gene [Source:MGI Symbol;Acc:MGI:1333

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22988 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28789
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081707 Nonsense 344 554 6 11
Genomic Location (Zv9):
Chromosome 17 (position 6099753)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6178689
GRCz11 17 6335919
KASP Assay ID:
2261-0549.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTATTTAAGACTCCTAAAATGAGAAAGCACACATTTATCTTGATATA[T/G]GCATGGTGAGCTTATTTCTTTTGTCATTAAATATGCATTTATACAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22988
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081707 Nonsense 477 554 9 11
Genomic Location (Zv9):
Chromosome 17 (position 6096233)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6175169
GRCz11 17 6332399
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCTTCAGCCAGTGATATCGGAGCAGTCGTTGCTCCGTTTATTCTGTA[C/A]AGATTAGCTAGTATTTGGCAAGAACTTCCCCTCTTGGTCTATGGTGAGAG
Associated Phenotype:
Not determined