Busch Lab

ZMP

NAV1 (2 of 3)

Ensembl ID:
ENSDARG00000058771
Description:
neuron navigator 1 [Source:HGNC Symbol;Acc:15989]
Human Orthologue:
NAV1
Human Description:
neuron navigator 1 [Source:HGNC Symbol;Acc:15989]
Mouse Orthologue:
Nav1
Mouse Description:
neuron navigator 1 Gene [Source:MGI Symbol;Acc:MGI:2183683]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa44650 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10320 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26844
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081703 None None 527 None 11
ENSDART00000113331 Essential Splice Site 51 660 2 17
Genomic Location (Zv9):
Chromosome 6 (position 54955964)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54973792
GRCz11 6 54983605
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGACCTCCATTTTGTCAATTTGTTTGTAACCTGTATTTTCCTCTCCTC[A/T]GTTCATGGATCTGTGCTGTCTCTGGCCTCAAATGCCTCGTCAAACTATTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26845
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081703 None None 527 None 11
ENSDART00000113331 Nonsense 128 660 5 17
Genomic Location (Zv9):
Chromosome 6 (position 54970198)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54988712
GRCz11 6 54998525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTGGCACTCATGACGGCACGACTACAGAGTCTGTCCGTCACTTCTGAA[C/T]AGAAGGTCAGTGTGTACAGCAACTACAAACAGTACATTTGGTTATGTTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26846
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081703 None None 527 None 11
ENSDART00000113331 Essential Splice Site 207 660 7 17
Genomic Location (Zv9):
Chromosome 6 (position 54972494)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54991008
GRCz11 6 55000821
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGCAGCCTGAAGGAGCAGGAGGCCAAAAAGAAGAAGAAGAAAAGCTGGG[T/G]GAGGATGTGAACAAGAAAACATAATAACCTGATTAAAAAAAAAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44650
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081703 Essential Splice Site 122 527 3 11
ENSDART00000113331 Essential Splice Site 428 660 12 17
Genomic Location (Zv9):
Chromosome 6 (position 54979867)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54998382
GRCz11 6 55008195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGGACGGACTGGTTTTCTCTGGACTCTGCTGTTATCCAGGCTTTTAAA[G/A]TGAGTGTCGGCCTCTGAAAACTCCTCATGTTGAGATGAAGAATGAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10320
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081703 Nonsense 507 527 11 11
ENSDART00000113331 None None 660 None 17
Genomic Location (Zv9):
Chromosome 6 (position 54992062)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55010252
GRCz11 6 55020065
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTGCAATCTGTGCTCNWTTGTTCTAGATGGCGATGCTGTTAAAACTA[C/T]AAGAGGCTGCMAATCACATCGAGTCACCRGAGAAAGAAACAGACCCAAAA
Associated Phenotype:
Not determined