Busch Lab

ZMP

zgc:100843

Ensembl ID:
ENSDARG00000058732
ZFIN ID:
ZDB-GENE-041010-82
Description:
Secretagogin [Source:UniProtKB/Swiss-Prot;Acc:Q5XJX1]
Human Orthologue:
SCGN
Human Description:
secretagogin, EF-hand calcium binding protein [Source:HGNC Symbol;Acc:16941]
Mouse Orthologue:
Scgn
Mouse Description:
secretagogin, EF-hand calcium binding protein Gene [Source:MGI Symbol;Acc:MGI:2384873]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25001 Nonsense Mutation detected in F1 DNA Not yet available
sa36035 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25001
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081649 Nonsense 45 272 2 11
Genomic Location (Zv9):
Chromosome 16 (position 7590926)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6436658
GRCz11 16 6377336
KASP Assay ID:
554-7395.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAAGGGAAAGAGCTGGATGACTTTTTCCGTCACATGCTGAAGAAACTA[C/T]AGCCAAAGGTATCAAACATAAACCACACAGGTTAATAAGAAATATAATCA
Long Flanking Sequence:
ACAGATATGAAGTAAACTGTAATAAGCTCAGTCAACAGTTTCATTTAGCATCATACTTGTTTTCGTGTCAGGCTTTTCGCTTATGACTGATGTGTGAAAGAGGAGGAGTTTATTTTCCTCTGACACACACAAACACACACACACACAGCTAATCGGAGGAAAGTGGCCACATCTGCAGTTGCTCCCACCGAGCACAGATCACATTACTCTTTCTACATCACTCTGTTTTTTCTTTTTCCATCATGGACAGTGCTTTTGCCAACCTAGATGCTGCCGGGTTTCTACAGATCTGGCAGCACTTTGATGCTGATGGTAATTTTTTCATATTTATGTACTTTTGTTTTTAAGTGACATACTTATACGTTTTGTGTACTCTAGTATTATCTCTATCTGTACCTCCATGTTTATAAACCTGCACTAATTCACACTTTTCTGCAGACAATGGCTACATTGAAGGGAAAGAGCTGGATGACTTTTTCCGTCACATGCTGAAGAAACTA[C/T]AGCCAAAGGTATCAAACATAAACCACACAGGTTAATAAGAAATATAATCATTAACAGATCTAAATTCTACATTTAAAAATGAGTTCATAAGTATATATGTTTGTGTTTATTGACTATTAAATCTCTATGAACGAATCATTTGATGTAAAACTATCTGAATTTATTACTGTTTAGGGTCTGTCGTTTCTCTTAAATGCTCATTTTACAATCTTTGTGATTCTAAAATGATTTTTGCATGTATAACACAGTCATTGCATGTTATTTTAATGGTTAATAGCATTATTTTTTATGCAAATGTGATTACTGTAGTATGAAAATGCTGAGTGCATGCACATGCACTTGTGACTGACATGATTTTATCTTAAGTTGACACAAATTGTTCAGGAAACTGTGGTTAGATGTGATCAAATGATACATTTTGCAGCTTTCTCTATGTTAGTGATTCTTAAACTCCCTTTACTTCAATCCACCACTATCATATTATTAAAATTGTAATAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3960
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081649 Essential Splice Site 108 272 4 11
Genomic Location (Zv9):
Chromosome 16 (position 7582334)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6428066
GRCz11 16 6368744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATCTTTCGCAGAGAGGCTCCATTAGATAACAGTGTGGAGTTCATGAAGG[T/G]AAACTTGCACATTACATAATCMCATTCTTCACAAATCCTGTTTGAATATT
Long Flanking Sequence:
TAATATAACTCTTCCTCTCATTTGGTTTAAATTCTCTGTATATCAGAGAAGAGATTGAACATACAGACCCATACAATCTACCCACCGACATCTTTCCTGATGATAAAATTAATAACCTCTCAATAGAAGAAATCTCAATTTTTATTACATCACTTCTATTTTAATCAACTTTAAATTGAACAGAAACCAGAGATAAATGTGTTCTATCATGGTTTTGATTGTTAAAATGACCAAAGATGCCGAGTTTCAGCTTATGGGTCAGCAGAAATATTGATATCTGCCTTGCATTGAGGAAGCAATTAATTTTTATGAGTGGAGACAGTTGATTTCACTATTATAAACCATTTTATTAGCTGGCACTAAACAATAAACCAATATTGTTTTATGTGTGTGTGTGTGTTTGTGCTAGCTGGCCAATATGATCCTGCCGCAGGAAGAGAACTTCCTTCTGATCTTTCGCAGAGAGGCTCCATTAGATAACAGTGTGGAGTTCATGAAGG[T/G]AAACTTGCACATTACATAATCCCATTCTTCACAAATCCTGTTTGAATATTAACGTTTTCACATTGCCCATGACAGATCTGGAGGAAATATGATGCTGACAGCAGTGGTTACATCTCAGCTGCGGAGCTCAAGGTGAACGTGCACACACGATACCTGGGAAGATGAAAACTACCAGTTACATTAATGTACAGTAATATAATCAACACACATGCAGTATATAAAATGGACAAAGTAAAGGAGAAAACCTTTTTAGGGAAGACCTATGTTGGCTCATCAAACCCAAAGACTTTTTTAAGATCTGAAAAGCTGAATTATAAAGTTTTTAATTTATGTATACTTTGTTAATATGGGACAATATTTGACTAAGATACCACTATTTGAAAATCTAGAATCTGAGGGATTAAATAAAATCTAAATACTGATAAAATCACTGTTAAGGTCTTCACTTTTAGGGCCCTATCATACACCTGGCGCAATAAGGTGCAAGACGTGTACATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36035
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081649 Essential Splice Site 230 272 10 11
Genomic Location (Zv9):
Chromosome 16 (position 7572581)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6418313
GRCz11 16 6358991
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGACCAGAGGTGGACGGCTTTGTCAAAGACATGATGGAACTAGTAAGG[G/A]TAAGTGCGTTGTACAAAACTCCCTATAGAGAGGCAAAATCAATCACATTA
Long Flanking Sequence:
AAATTGTAACGAGAGCACCACTTCCAGCACGTCTTGGTATACTAGTTTGGTGTGCAAACCAATCGCACCACGAAGGCAAATGAACTCTGGCATGTTTTTACAGAACTAAACAAGGCAGGTGTGAAAGCACCCTAAGCATACACACCACAAAATAAAGTGACACCTCTTTAAAAAAAATAATAAATCAAGTGACTCTGTTTCCTGTCCTCCTCAAGGCCAGCAGTCAAGTGGAAAGAAAAAGAGACTTCGAGAAGATCTTTGCACACTACGATGTTGTAAGAGCTGATTTTAACCTTCATTTCACTGTACATCACTCTGTGTGGATGCATTAACTCATTAACAGTGTGTCTTTTTTGTTGTTGGCCAAGTTACCTGATGCATTAGATATTGAACATGATGCTCCGTCCATTAATGTCCGTCTCTCATTCTAGAGTAGGACTGGAGCACTTGAAGGACCAGAGGTGGACGGCTTTGTCAAAGACATGATGGAACTAGTAAGG[G/A]TAAGTGCGTTGTACAAAACTCCCTATAGAGAGGCAAAATCAATCACATTATGCTGTCATCAACTTTTTAACAAACTTCATTCAACCTAATTTTCTGCGACTGTTTAGGATTTCAGATTTATTTGTCTATAGAGCACATGACTAGAATTAACAAACAGCAGTAATACTATTTGCTCCACACAAAAACGTTTGTTTATACTGAAATTGGCTTTGAACAAGTTTTAACAGAAATTGGCTTTGAACAAGTGACGGGTGTGTAAATAACCACATTTAAAACATTTTTGGGTGAACTATGCCTTTAAAATCTTAAACGTTATATAACAGAAAGTAACTGTAAAATAATCAATGTTAAATAACAGAAATTTACTGTAAAATAAAAGATGTTAAATAACAGAAATTTACTGCAAAAAAGGGTCATGAAATTACAAAAAAATACTGTAAAAAACGGCTGTTAAATAACAGAAATTTACTGTAAAATAACGGATGTTAAATAACAGAAAA
Associated Phenotype:
Not determined