Busch Lab

ZMP

terf1

Ensembl ID:
ENSDARG00000058710
ZFIN ID:
ZDB-GENE-090612-2
Description:
LOC566954 protein [Source:UniProtKB/TrEMBL;Acc:A7MD83]
Human Orthologues:
TERF1, TERF1P2
Human Descriptions:
telomeric repeat binding factor (NIMA-interacting) 1 [Source:HGNC Symbol;Acc:11728]
telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 2 [Source:HGNC Symbol;Acc:38110]
Mouse Orthologue:
Terf1
Mouse Description:
telomeric repeat binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:109634]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32480 Essential Splice Site Available for shipment Available now
sa24459 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30060
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106008 Essential Splice Site 83 386 1 10
ENSDART00000134482 Essential Splice Site 62 365 1 10
ENSDART00000139212 Essential Splice Site 65 303 1 9

The following transcripts of ENSDARG00000058710 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13253410)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13204858
GRCz11 24 13349277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAGAAAGGTCTTCGGTGGAGTTTCGAAAAGAACTGAAGTTATTTGAAG[G/A]TAACGTAATGAGTTTACATGCTAACCTGTTTTGATGTGAAGTTAAACATC
Long Flanking Sequence:
AACATACTTTGCTAACGTGATAAGCTAAGTTACTTACAAAGGTGAGTGCTACTTTTCACACCAAATGAAGTTGTTTTTTCTCATGTTGGACGTTAGTAGGACAGTAGGACTACTCGGAGAAAATATTGAAATTAAGTATAAAATTCACCTTAGTGTTAACCTTACAGGTACTGCACAATAATGTGCTAATTTTATCAAGCAAGCAACGTTACTTTCTGTGCGATAGGAGTTGTGTCCTCCGCGCCAATAGATGGCGCTGTGCCCACGGTTTATAATAAACAAACAGATGGCGGGAACGTTCGGTTGTGGTTTCATAATCATAAACCTGAAGATGGAGTCGGAGTCACATGAGATTACGAGTACTAGTGATAAAACAACTTCACAAGAAGTTAATAACGTTGTTCAGTCATGGATTATTGACTATTATTTTGCAACATTATGTCGGCTTTTTAGAGAAAGGTCTTCGGTGGAGTTTCGAAAAGAACTGAAGTTATTTGAAG[G/A]TAACGTAATGAGTTTACATGCTAACCTGTTTTGATGTGAAGTTAAACATCAAGCGGTAACTTTGCTTACATTTTGACTTCCGCTTGGTGTAACACCCTTGTAATGTTTTGTTTTTTATTTTGATGTGTTTAGGTTTAGTGGATGAGCTCGAATCACATTCCTCTCAGAGAACCGTCTGTTGCTTCCTAGCCAGAGTGATGGACGGGGAAAACCTGGGTAAGTTCATGTCAACACATAAGAAAATAACACAGGCTATGTGTCGGAAAATAATTTTTAGTTTTTAGTTTTAGTTTTCTTTGGAAGCACACTACTGGTCCTTGCTGTAATTTGCAATATTATATACAAGAATTTTACATTTTATTTTAGTTCAGTATTTACCAAGGTCCAGGATTTTTAAAATGTGTATTATGTTTGTTAATACTTTTTTGTCTGAAGCAGCTGAAACAGTAATAAAAACCGAGTTTAAGTGTAACACACACTATAATAATATAAATGTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32480
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106008 Essential Splice Site 278 386 8 10
ENSDART00000134482 Essential Splice Site 257 365 8 10
ENSDART00000139212 Essential Splice Site 253 303 8 9

The following transcripts of ENSDARG00000058710 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13245293)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13196741
GRCz11 24 13341160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTACTTTCATTATAATTGCTTTAATAACTGAAGTGATTCTGTTATGCA[G/A]ACCCAAAAGAAGACTTCTTCCAAAACAAAATGATCCATGGAAGCCAGAAA
Long Flanking Sequence:
GGTGGTTTAGATCCCTCACTCTGCAATTTAGTGACATTTAAAACAAAAAGGGAATGAAAAACTAAACAAATTATAGTGCATTTCGCTATAAACAGCATTTATCAATCTGACAAGGCACATTTCAGATGATAAATGACATTTCATTCTAGTCACTTATGAATGTAATAGCCCTTTTTAATTATTGAACATCTTTATTTATAGATATGATTAAGGTTTTATTTATAAATATTATGTGCACTTGAGCTAATGATGTCTTTATTTTCTGCTTTTGTTTCCATACAGAAATGAGGAACATGAGGATCCACTTGTGGTAAATATCAGGTGAGGTCTTAAAGTGGTTTCTGCACCAGAATAAACTTCCAAATGTATGAATATTAAGAGTCACTGTAATGACTCACTTTTAATTATGATTAGTGAAACTCTCCTCTCCTATATTTAAAGACTTTATTCCATTACTTTCATTATAATTGCTTTAATAACTGAAGTGATTCTGTTATGCA[G/A]ACCCAAAAGAAGACTTCTTCCAAAACAAAATGATCCATGGAAGCCAGAAACTGCAAAGAAAGCTCACGCCACACTCAAGAGAACCTCTATTTGCAGTAAGTTAACTCCAGTAAGGGAGTGCTTTCCCTGGTTGAACTTTTAATTTTTAGTATTGATCCTTTGAGTCTATTTCCCAATAAGTGATTATTTTATTCTCAATTCAAGTGATGCAAATTATGCTTTATTAGCAAATTATTCATATCATTTTTTAATTTGAAACTTGGTTAGTGGTTTCCATGTCTAATAAACAATGCGTACTATACACAGTTCTTTAGAGAGTCCCTACCTTCCATGTAGTGTGTCATTTTGCTGTTTTAAAATGTGAAAGTGTATCAAATCTCAAGAAAGAATCAGTTGAATCTCAACTGCTTAAATTAGTCAACAGCAATTCCAGTTTCACTTTCATAACTGGTCTGCATAGTCTAAATAAACCCTTTATTTATTTATGGAGCTTATTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24459
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106008 Nonsense 335 386 10 10
ENSDART00000134482 Nonsense 314 365 10 10
ENSDART00000139212 None None 303 None 9

The following transcripts of ENSDARG00000058710 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13241948)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13193396
GRCz11 24 13337815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGAGAATCAATGTGTTGTTGTTTTTTGTTTGTTTGTTTTTTCAGAAAT[G/A]GACTGATGTAGAAGACAAGAAGCTGAAAGCAGGTGTGAAGAAACATGGGG
Long Flanking Sequence:
CCTTCAAACCTCAAAAAAAAACATTAATATTGTCAAGATAATGGTCTTTAAAATGTGGATCACAACATCAATGAAGTCTTTCTTTGTGCAATTATTCATATTTAACCATTGATGAATATTGGTCTTATTCACACAGAGGTTTCCAGGAGAAGTAATACCCCTTCCGAATTACACAGCAATATTACTGTGTCACGCCATTCCAGGAAGGTGAGTTACTTCTCATTGTCTTCCTTTCTAGTGCAAGCATGCATTTAACATTTTTTTCATCTTTATTTCTATAGCGCTTTTACAATGTAGATTGTATCAAAGCAGAAGTTCTAGTCAATTGCAATTGAAATTATCGGGCCAGTTTTCAGAGCTGAAGTTCAGTTTAGTTTAGTTCAGTTCAGTGTGGTTTAAATTTCACTGCTGAAAGTCCAAACACAGAAGAGCAAATCCATCAAAACATATAAAGAGAATCAATGTGTTGTTGTTTTTTGTTTGTTTGTTTTTTCAGAAAT[G/A]GACTGATGTAGAAGACAAGAAGCTGAAAGCAGGTGTGAAGAAACATGGGGTTGGCAAATGGAGCAAAATCCTTAATGACTTTGATTTTGACAATCGCACCACTGTTAATTTGAAAGACAGATGGAGAGTCCTAAAGAAACAGAATCTTGTCTCTTGAGCTACAGCTGCCTTCTGCTTTTAATATTTAAAGACATTTCTTGTATTTCAGTTCTCAGCTGTGCATAGTGCTTGTGCAATATATATTTATATTTTAATGGTAGATGTTTTTTATTTCTTTAAACCAATTTACTTTATTTAGTTTACAACATAACCAACATTTTTTTACGATGTCACAGAATTTCAGCAGTTATACATGTCATTTCACACAGCAAGTAAAAAATGTTAGTATTTTTTCTGAATTGATTAAAAGCTTTCAGCATTATGTTGCCATTTATTTAAACTGTAAGACCAACATTTGTCCAGTAGAGGATGCAGATGAGTCTAGAGTAAGCTTTGTTTTG
Associated Phenotype:
Not determined