Busch Lab

ZMP

ENSDARG00000058685

Ensembl ID:
ENSDARG00000058685
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12967 Nonsense Available for shipment Available now
sa29158 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12967
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053387 Nonsense 161 803 1 1
Genomic Location (Zv9):
Chromosome 19 (position 8321257)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7779796
GRCz11 19 7698721
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTTTCGTCAGACTWGGAAAAAATCCAAATATTTCCAAATCTGAGCTTT[T/G]AAACAAGCTCCTTTCAACCAGTCAGCAAAAMCATGATGCTTTTGTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29158
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053387 Nonsense 408 803 1 1
Genomic Location (Zv9):
Chromosome 19 (position 8320517)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7779056
GRCz11 19 7697981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATGCAAGAAAACAGAACATTGAGCACTACAAGAGTGAACTCAAAAGT[C/T]AAATACAGAATCTTAGAATGGAACAAGGAAGCCACAGGATGAGTGACACA
Associated Phenotype:
Not determined