Busch Lab

ZMP

aqp10b

Ensembl ID:
ENSDARG00000058678
ZFIN ID:
ZDB-GENE-060503-57
Description:
aquaporin 10b [Source:RefSeq peptide;Acc:NP_001076516]
Human Orthologue:
AQP10
Human Description:
aquaporin 10 [Source:HGNC Symbol;Acc:16029]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39229 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3026
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081592 Nonsense 16 309 1 6
ENSDART00000140719 None None 276 1 6
Genomic Location (Zv9):
Chromosome 19 (position 8432609)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7891148
GRCz11 19 7810073
KASP Assay ID:
554-3351.1 (used for ordering genotyping assays)
KASP Sequence:
CAGTGATGGACCGTCTGCTGAGGAGATRCCGAATCAAGAGTCGTCTGCCC[A/T]GAGAATGTTTGGCGGAGTTTTTTGGAGTCTATGTTTTAATAGTAAGTCAA
Long Flanking Sequence:
TTGTTTCAATGTTAGATGTAAATTCATAAAAGATTAGAACCAGTTTAGTGTGAGTAAACAAGGGATTTTTTTAGTTTTGGGTGAACTGTGCCTTTAAGCTGTGTTTTCCAGTATAATTTGTCAAAAAAAAAAACTTTTTTTTTTTTTTTTTTTTTAAAGTGAAGAGTGAAATATTTCTGCACATAGTCCTGTATATGCCAACAGTGCATCACAGATAAAGGTTAACAATAAACTGCTCATCGTTTTATGACACAAAAGGGCAATGTACTACCTGTAATGGTCTATCCTTCCCCTGACAGACACATAAAACACACTTTAACCACAACAGACACTCTGAGTTTACTCGTGTGCTGTGATAATGAGTTCTTCTGGATGAGCATGTTTTCATTACAGAGCTTCTCCATAATCTAATGAATCTGGCATTTACTTCACTGTAAACAGAAGAAAGTGCAGTGATGGACCGTCTGCTGAGGAGATACCGAATCAAGAGTCGTCTGCCC[A/T]GAGAATGTTTGGCGGAGTTTTTTGGAGTCTATGTTTTAATAGTAAGTCAAAAATCTTAACAATTGCATTTGCATCATGAACATGTGCTACATGAACTGAGGCTTAAATTTATGAATGTTTGGAGATTCGTATTATGTTATTTGGGAACTTTAACAATTAGGTTAAATGAACTAACAATGAAACACTCCACTTACTGCTTGCTCAAACTGCTTATTTAAATGAGCTGAATCAAAACAATTCTTGATTTCTTTGGAACAACTGAATTATTTTATATTCAATCCACTTAAATTTGTAAAAACAATCAAGTTAACACAATCAATTTGGAAACTGAGTGGATTTTTTTTTACAGTCTACAATATTTAATAATCTTAGTTAATGTTAATGATGGTTAATAAACATACGACTTTTAATTATTCATGTTATTAATTTTACTGTCAATTAGTAAATAGTAAAATTGATAAATCTGGGTAGTAAAATTAAGAAATGGTAACAAATGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39229
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081592 Nonsense 255 309 6 6
ENSDART00000140719 Nonsense 222 276 6 6
Genomic Location (Zv9):
Chromosome 19 (position 8438658)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7897197
GRCz11 19 7816122
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCTATAATCGTAACGTGTGTCGGGGCTCTTCTGGGATCATTACTGTAC[G/T]AGCTGCTGATTGGAGTTCATCATCCTGACTCAGAGGCAGTGGATCATGAA
Long Flanking Sequence:
AACGATTATGAAGATTAAAAGAGAGATTGAACAATGTATTCAGTTTTGAAATGAACAAATGCCTGTTCTGCAGATCATTGGCACGGCTGCTCTGCTGGTGTGTGTTCTTGCATTGGGAGATGCTCATAACACACCTGCACCTGCAGGTCTGGAGCCTGTGCTTGTCGGAGCCGCCGTGCTGGTGATCGGGATCTCCATGGGGTCTAACAGCGGATATGCCATCAATCCAGCCAGAGACTTCGGCCCAAGACTCTTCTCCTACATCGCAGGCTGGGGAGACGAGGTGTTCAGGTCAGTCGAACATTCCAACTTCTTACTTACAAGCTACTTTATAAGGTAGACAACTGACATGCGCTCAGTTTTGATATACAAAGATGTAGTTTTGATATAAAAAGGTAATTTAATTCTTTGATTGTTGTTGTGTCAGGGCTGGACATGGATGGTGGTGGGTGCCTATAATCGTAACGTGTGTCGGGGCTCTTCTGGGATCATTACTGTAC[G/T]AGCTGCTGATTGGAGTTCATCATCCTGACTCAGAGGCAGTGGATCATGAAGACCCGACAGCGGCGCTCCAGCAAACTGTCGAGATGGAGGGTGCGCAGAGTTTTGACACCATTAAAGAAAACAAAAAGAGCGGGATCTTTTCTATAACCTCAGCAGACGTAGGGTAAAGTGAAAGAGAGTATATTAAACGTCTTTTGGAACCTAAATTGTTACCGTTTACATTGAGTGCATTTACAAATTATCGTGATAATGCTCATGCTTTAAAAATAATCTTCAATTCTATTAACTGGGAGAGCTCATTCATTCATTTTCCTTCAGATTAGTCCCTTATTTATCAGGGGTTGCCACAGCGGATTGAACCGCCAACTATTCCAGCATATGTTTTACACAGCGGATGCCCTTCCATCCACACCCAGTACTGGAAAACACCCATACACTCTCATACTCATACACTACAGCCAATTTTGTTTATTCAATTCAGTTTACCTCACACCAACACG
Associated Phenotype:
Not determined