Busch Lab

ZMP

ilf3a

Ensembl ID:
ENSDARG00000058660
ZFIN ID:
ZDB-GENE-030131-3151
Description:
hypothetical protein LOC324431 [Source:RefSeq peptide;Acc:NP_001025236]
Human Orthologue:
ILF3
Human Description:
interleukin enhancer binding factor 3, 90kDa [Source:HGNC Symbol;Acc:6038]
Mouse Orthologue:
Ilf3
Mouse Description:
interleukin enhancer binding factor 3 Gene [Source:MGI Symbol;Acc:MGI:1339973]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15639 Nonsense Available for shipment Available now
sa16142 Essential Splice Site Available for shipment Available now
sa33812 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15639
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081561 Nonsense 587 820 15 19
ENSDART00000128640 Nonsense 587 820 14 19
ENSDART00000131513 Nonsense 191 208 5 5

The following transcripts of ENSDARG00000058660 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 9423639)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8137023
GRCz11 6 8372562
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCAAGAATCCCGTCATGGAGCTCAATGAGAAGCGCAGAAGTCTGAAATA[T/A]GAGCTTGTCTCTGWCAAGGGACGCTTCAACGACAAGACCTTCACTATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16142
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081561 Essential Splice Site 652 820 17 19
ENSDART00000128640 Essential Splice Site 652 820 16 19
ENSDART00000131513 None None 208 None 5

The following transcripts of ENSDARG00000058660 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 9425853)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8134809
GRCz11 6 8370348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCTTTTCTTGAATAGGTCTACAATATTTGATGTTTTTGTTTTTCTTTA[G/A]GGATATGGTATGGGTGGGGTGTCTTTCAATCGAGGCAGGGGTAGAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33812
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081561 Nonsense 801 820 19 19
ENSDART00000128640 Nonsense 801 820 18 19
ENSDART00000131513 None None 208 None 5

The following transcripts of ENSDARG00000058660 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 9429819)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8130843
GRCz11 6 8366382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACCACCTGGAACAACAAATCAGAGCTATAACTTCACCCAGAGCGCATA[T/A]CCAAACCTGGGCGGCTACAGCAGCGGTGGAGCGAGCACCACAGACTACAC
Associated Phenotype:
Not determined