Busch Lab

ZMP

si:dkeyp-39e9.3

Ensembl ID:
ENSDARG00000058649
ZFIN ID:
ZDB-GENE-060503-466
Description:
tripartite motif-containing 46 [Source:RefSeq peptide;Acc:NP_001076569]
Human Orthologue:
TRIM46
Human Description:
tripartite motif-containing 46 [Source:HGNC Symbol;Acc:19019]
Mouse Orthologue:
Trim46
Mouse Description:
tripartite motif-containing 46 Gene [Source:MGI Symbol;Acc:MGI:2673000]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18362 Nonsense Available for shipment Available now
sa32232 Nonsense Available for shipment Available now
sa36782 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18362
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081546 Nonsense 209 739 4 11
Genomic Location (Zv9):
Chromosome 19 (position 9219154)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8677693
GRCz11 19 8596618
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATCATGAATTGTRTCTGTCTGTAGGTGCTRACATGCCCAGAACACGAT[C/T]AGGAGAGGCTGCAGTATTACTGTAAGTCATGTCAGATGCTTCTCTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32232
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081546 Nonsense 245 739 4 11
Genomic Location (Zv9):
Chromosome 19 (position 9219044)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8677583
GRCz11 19 8596508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCGTCGAGTCCATGCGGGTCACAAAATTGCACCCGTCACCCAAGCCTA[C/A]CAGACTCTCAAGGTTTGTTTATCATTTTACCTCTGTTTTAATCTTGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36782
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081546 Nonsense 728 739 11 11
Genomic Location (Zv9):
Chromosome 19 (position 9205492)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8664031
GRCz11 19 8582956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTACAGGAGCTGGTAGCCAATCGTAACGCAAATCAAACCCCTGTGAGA[C/T]GAGTCACCATACAATCACGTGTCACAAAACTGAACTGACCTTCGTTTTTA
Associated Phenotype:
Not determined