Busch Lab

ZMP

ENSDARG00000058631

Ensembl ID:
ENSDARG00000058631

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa35199 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35199
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106566 Nonsense 116 140 4 4
Genomic Location (Zv9):
Chromosome 12 (position 5445131)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4499233
GRCz11 12 4534245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGAGAGGCTGTCAGCTGGGAACATGTCAGGTTCACAATCTGGTCAAC[A/T]AGTTATACCGAATGGGTCAGAGCAACGGCAAAGACGAGTCCAAAAAGGCA
Long Flanking Sequence:
ACAATACAATATAATATAGTATAATATAATATAATATAATATAATATAATACAATACGATACGATACGATACGATATGATATGATATGATATGATACGATACAATACAATACAATATAATATAATATAATATAATATAATATAATATAATACGACACAATACAATACAATATAATACAATATAATATAATATAATATAATACAATACAATATAATATAATATAATGTAATATAATATAATATAATATAATATAAAAATTATTAAAACATAGTTATTCTGACCAGTTTTCATTTAATCAAAATGATCCAAATGACAAATCGGGAAGTAATGTTATCAGACCTTTTATAAAATAAAACAGAACAGTTTTATTGTCTCCCAATGAAGGGATCAGCAGGGCTGTTGAAGCATATGAGCTGATGTTTGTCTTCTCTCTCTGCAGAAAGCGAGCCGCTCAGAGAGGCTGTCAGCTGGGAACATGTCAGGTTCACAATCTGGTCAAC[A/T]AGTTATACCGAATGGGTCAGAGCAACGGCAAAGACGAGTCCAAAAAGGCAAACGATCCAACAGGATACGGACGCTGAGAATATAAAACTGCTTCTGCTTATTCATCAAAGGACAGAATGTATTCGACCGGTACTGCTCTGAGTATTGCTAGGAACTCCAAATAAATTATTCTCTATTGTATGGACTAATTAATTAATTCAAATATTGCATGTCTTTGATAGACTACGGATAGGCTGCTCTATTGTATAAAAAGTGTATATTCTATTTAAAAATGTATATAAAGATTATAAAAGTACTAAAATAAACAAATAACACACACAAAAGGCTTTATGGTTCACAATTTGAGTATATTGTACATGTTTTAGATATTTTAGTGTATATTTTGCTCTCGTGAGGATACAGGGTCTTTATAGTTACAGACTATACAGACTATATAGTTACAATACAGTACAGACTGTATTAACTATTGCCCTACCATATCCCTAAGCCCAACCCTCACA
Associated Phenotype:
Not determined