Busch Lab

ZMP

zgc:123008

Ensembl ID:
ENSDARG00000058562
ZFIN ID:
ZDB-GENE-051113-232
Description:
hypothetical protein LOC641418 [Source:RefSeq peptide;Acc:NP_001032484]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24080 Nonsense Available for shipment Available now
sa29722 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4983
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081446 None None 646 None 3
ENSDART00000129401 Nonsense 17 646 1 2
ENSDART00000138343 None None 242 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 10016810)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9876978
GRCz11 22 9906660
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATGAGTGATCCAGGAGCCTGCACAATAAAACAGGAAGATACTGAAGAA[C/T]AAATAGGTTGGTGATTTATTTTATTTTATTTTTTTACCTGATTTTTTTTNNN
Long Flanking Sequence:
TACTTTTCTCTCAAAAATTCACAGTTAGTATTATAAAAAACAATTAAAAGATCAGTTACAATTGTTTCCTCACAATCTATATTATTTTTTCAATAGACACAGGACTGTCAGTGATTAAATCATTAAAGGTTTTTTTTTCACAATCTAGAACAACTATATCCTCCACAGGGAGTGAATCTGGTTTAATATATTACTTAGTTGCAAGCAAAATATTAGTTAAAGCAAAATGTCTGTAGATTTGACTTATGCAAATATTATAATATAGTAATAAAATATGTTATACAAAAGAACAAATTCACTGACAATTTCACAGTGCCATAAGTTATGTAATTAATTTATGTGTTTTATTTTGGCAGTTCATTTATATAGCAGTCCTCCTGCAATAAAGCTTTACCAGTAAATGCTGAAATAATTCCATCAACCAAGAAGTGAAGCAAATTTTGTGATAGAACATGAGTGATCCAGGAGCCTGCACAATAAAACAGGAAGATACTGAAGAA[C/T]AAATAGGTTGGTGATTTATTTTATTTTATTTTTTTACCTGATTTTTTTTCAGATGTTTATATGAGTTCACAATTCAAACATACTTATTTAGCAGCCATGGGCTGGTATAAGTTTCTGGCATTATGATAACCTTGGATAAAAATATCACGGTTTCATAGTATTACGGTCCTGTGATTACTGATCTAAAATAAGTTCTTTTTAAATGTCTGGGTAGCTAAACTTTTCCCCCATTTAACAAAATACATTTTATTTTAGAAAACATTTATAATATTTTGGAACAGTAAACATGTCTGGCTGAATAACAAAATAAATCATTGCCTTCAGGGGTCTGTTCTTCATACCTTGCTTAAATGATCTAAGATGATTTGGCAGATCCTGGATCTGTTCATCTTGATAACTGATCTCTCACTAATTTGGTTCTTCAAACAAGTTTGTGAATCAGATTAAAATGTCTGGATGAACTGATCTGAGATCGCTGCATGTGTTGTGAAGGACTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24080
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081446 Nonsense 17 646 2 3
ENSDART00000129401 None None 646 None 2
ENSDART00000138343 Nonsense 17 242 2 3
Genomic Location (Zv9):
Chromosome 22 (position 10004359)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9864527
GRCz11 22 9894209
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATGAGTGATTCAGGAGTCTGCACAATAAAACAGGAAGATGCTGAAGAA[C/T]AAATAGGTTGGTGATTATTCTTGATTCTGTCTTTTACCAAAACTAGCAGC
Long Flanking Sequence:
TTATCTTTGCTGATTTGCCAAATCAGTATGTAAAATATCTGTAAAACTGTCAAATATACATTCATTTGGTAAGTGTTCTTTTTTTTTTTTGCCATCCTTGCATTCACTATCACTCAGATGAAATAAGTAGCTTTTAAATTTATGGTTTTTATTAATTTTCTGTCTCTAAATTGACTTTATTAAAAGAGCAATATACTGTGCTTCTGTGTTGCTGTGTAACCACTGTATCAACAGTCTTGGTGCTGGAGCGCATGACATTGGGCACTTTTTCTGCAGAGAGCTGTCTTTTATTATCATTTAATTTGTAAATTATACAAGCAATTACTATAAAGTTGATAACAGTTTTATGTTTTATTTTGGCAGTTCTTTAACTGTGAAGCTTCACCAGTAAATGCTGAAACATTCCCATCAACCAAGAAGTGAAGCAAAGTTTGTGAGAGAACAGTGAGAACATGAGTGATTCAGGAGTCTGCACAATAAAACAGGAAGATGCTGAAGAA[C/T]AAATAGGTTGGTGATTATTCTTGATTCTGTCTTTTACCAAAACTAGCAGCAACTCATTAGCTAAAGTTTTTATTTACAACAAAGATTTCCCACAAAATCCAACAATTTAAATGAACATGTGGAAATGTTCATATTTGCAAATATTATTTCAGGAAATTATTTTATTTGTTGTACTGTATGTGCTAACATTTCCTTTTTGTAAAAATAATGAGTTTGAGTTGTTCAAAAATGGTGGGGTCAGTGGCGTGGCGGACGGGCCCTCAGGAAAGGGAAGTGATCCCTGCAGTGCTACGCCACTGGGTGGGGTCAAATGAAAAGATAACTAGAGTAGAATGATTATAAGGATGTTGTTTTGTGACATCTAATTTTTTTTGTCTTTAATATTTCTAACTTTTTGAAGCCTGTTTTTCTTTTGCTTTCATTTTAGACTTGTTAAATGAGAACAAGGAGATTGAAGATCTGATTAAAAGGGGAGAGAAACATCACATCAAAACAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29722
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081446 Nonsense 151 646 3 3
ENSDART00000129401 Nonsense 151 646 2 2
ENSDART00000138343 Nonsense 151 242 3 3
Genomic Location (Zv9):
Chromosome 22 (position 10003534)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9863702
GRCz11 22 9893384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGGAGAGAAGCCCTTCATGTGTGATCTATGTGGGAGGAGTTTTCTTTA[T/A]GCAAATACATTAAAAAAACACCGAAATTTACACAGCGCTGTGAAGAATCA
Long Flanking Sequence:
AGAGTAGAATGATTATAAGGATGTTGTTTTGTGACATCTAATTTTTTTTGTCTTTAATATTTCTAACTTTTTGAAGCCTGTTTTTCTTTTGCTTTCATTTTAGACTTGTTAAATGAGAACAAGGAGATTGAAGATCTGATTAAAAGGGGAGAGAAACATCACATCAAAACAGAAGAAAACCTTTACAGTATCTCAACGATAAGAAAAGACAATCCATGTTTCACATGCCTTCAGTGTAAAAACACTTTCTCATGCGAGGAAAGTCTAAATCTTCACATGAAGATTCATAGAGAGGTGAAGCCACACACCTCTGATCAATGTGATGAGATTTTCACCGTAAAAGTTACAAATAACGTAAATGTCCACGCTGAGGAAACGGTGTACAATTGTGATCAGTGTGACAGGACTTTCACAGATAAGAGAAATTTAGCCGCACACATGAAATTTCACAGCGGAGAGAAGCCCTTCATGTGTGATCTATGTGGGAGGAGTTTTCTTTA[T/A]GCAAATACATTAAAAAAACACCGAAATTTACACAGCGCTGTGAAGAATCACGTCTGCTCCAAGTGTGGCAAGAGCTTTTTCACATTCAGTCAATTAAAAATCCACCACACAGCTCACGCTACAGAAAAACCTTTCAAATGTTCACACTGTGGCAAGGCGTTCAAATCATTACAGTGTCAACGAATACATGAGATGATCCACAGCGGAGAAAAGCCACACAAGTGCGATCAGTGCGAGAAGACTTTCAGACAGAGGAAAAGTTTAAACATCCACATCAGAATCCACACTGGAGAGAAGCCGTACACGTGCGATCATTGTGGGAGGAGTTTCAGCAGAAAGGAAACCCTTAACAGTCACTTGAAAACCCACTCTGGGAATATGCTGTACACTTGTGCTGAGTGTGGGGAAGGTTTCAACAATACAGGAGATTTTACAGCACACATGAAAACTCACTTTGGAGAGAACCCTTTCTTATGTGATCAATGTGGGAAGGGTTTTCC
Associated Phenotype:
Not determined