Busch Lab

ZMP

lama5

Ensembl ID:
ENSDARG00000058543
ZFIN ID:
ZDB-GENE-030131-9823
Description:
laminin subunit alpha-5 [Source:RefSeq peptide;Acc:NP_001034260]
Human Orthologue:
LAMA5
Human Description:
laminin, alpha 5 [Source:HGNC Symbol;Acc:6485]
Mouse Orthologue:
Lama5
Mouse Description:
laminin, alpha 5 Gene [Source:MGI Symbol;Acc:MGI:105382]

Alleles

There are 21 alleles of this gene:

Allele Name Consequence Status Availability
sa24260 Essential Splice Site Available for shipment Available now
sa9662 Nonsense Available for shipment Available now
sa25193 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18267 Essential Splice Site Available for shipment Available now
sa9446 Nonsense Available for shipment Available now
sa43919 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16078 Essential Splice Site Available for shipment Available now
sa16193 Essential Splice Site Available for shipment Available now
sa37625 Nonsense Mutation detected in F1 DNA Not yet available
sa18231 Essential Splice Site Available for shipment Available now
sa43918 Nonsense Mutation detected in F1 DNA Not yet available
sa43917 Nonsense Mutation detected in F1 DNA Not yet available
sa24259 Nonsense Available for shipment Available now
sa29878 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6725 Nonsense Mutation detected in F1 DNA Not yet available
sa16872 Nonsense Available for shipment Available now
sa13881 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5030
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 278 3664 5 80
Genomic Location (Zv9):
Chromosome 23 (position 9813703)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9771844
GRCz11 23 9706814
KASP Assay ID:
2261-7372.1 (used for ordering genotyping assays)
KASP Sequence:
GGGTCACCTRATGGGCAAAACCTTGAGAGACCCCACAGTCACACGAAGAG[T/C]AAGACTMCACTTCAGTTTTTAGAATGGACAGAAATTAYAAACAAAGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24260
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 311 3664 6 80
Genomic Location (Zv9):
Chromosome 23 (position 9813078)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9771219
GRCz11 23 9706189
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGCCACGCTGAGGCCTGTAATGCTCAAGACCCCAATGATCCCTACAAG[T/C]AAGTGACCTTTAAGAATGTTTCATTTATTTATGTGTTTTTAAATGTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9662
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 388 3664 8 80
Genomic Location (Zv9):
Chromosome 23 (position 9790070)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9748211
GRCz11 23 9683181
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCTGGACATGCAGGGAGAATACAATGGCGGTGGAGTGTGTGTCGAGTG[C/A]CAGGTGGGCTCAGGTGTACAAACATACAATTATKAAGCAATTGKAGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25193
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 664 3664 16 80
Genomic Location (Zv9):
Chromosome 23 (position 9775068)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9733209
GRCz11 23 9668179
KASP Assay ID:
554-7863.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAAGACCTTCTTGAGCAACAGGGGATTAAGTTCAAACCTGTCTGTTTC[A/C]GCATGTGATTGCTCAGTGGAGGGCTCTCGCTCCAGCTCCTGTGATCCAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5029
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 1546 3664 36 80
Genomic Location (Zv9):
Chromosome 23 (position 9738730)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9696871
GRCz11 23 9631841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCCCCTCAGGTGCAGGAACAACATTGTTGGCCGTCARTGTGACAGGTG[T/A]TCTCCAGGTTTCTATGGTTACCCCAACTGCAGGCCATGTAACTGCAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18267
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 1904 3664 44 80
Genomic Location (Zv9):
Chromosome 23 (position 9727666)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9685807
GRCz11 23 9620777
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATGCCTCTGTCATAGAGTAAAAGATGTTNNNTGTTTGGTCTTGTTYAC[A/C]GTTTTGCTATTCGCWGTGTGGAGAAGCCCAATAATATGCGGTGCCTGTGY
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29879
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 2145 3664 48 80
Genomic Location (Zv9):
Chromosome 23 (position 9723896)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9682037
GRCz11 23 9617007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCAGCACAGCGTCCCTGTGCAGAATGGAGCAGATATGCACTGTCAGCG[T/G]AAGTACTGTGTCACTGCACTGCACATGCTTCATTCACTCACTTGCTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9446
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 2164 3664 49 80
Genomic Location (Zv9):
Chromosome 23 (position 9721582)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9679723
GRCz11 23 9614693
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGTGTGATGGTGCTGCTGGAAGATYTGGACAGGATCMGTCATTTTTA[T/A]GAGTCCGTTGCCAATCAGCTGACCAGCCTCAATGCCAGCACCTTCGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43919
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 2195 3664 49 80
Genomic Location (Zv9):
Chromosome 23 (position 9721487)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9679628
GRCz11 23 9614598
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCTGGACTCAACTAAACCGCCTTAATGCCTCCATTGCGGACATTGCTG[T/C]GAGTCTCTTTCTAACATAAACACTATCAGACTTTTGCCGTTAACTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16078
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 2270 3664 52 80
ENSDART00000045126 Essential Splice Site 2270 3664 52 80
Genomic Location (Zv9):
Chromosome 23 (position 9720373)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9678514
GRCz11 23 9613484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTGAAATRYCACAGACAAAGTCAAGTGATGGCATTTGTGCATCTGCTC[A/T]GACATYATACAGCAGGTGAAYCGGACAGCRCAGAATGAGACGCAGGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16193
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 2270 3664 52 80
ENSDART00000045126 Essential Splice Site 2270 3664 52 80
Genomic Location (Zv9):
Chromosome 23 (position 9720373)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9678514
GRCz11 23 9613484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTGAAATRYCACAGACAAAGTCAAGTGATGGCATTTGTGCATCTGCTC[A/T]GACATYATACAGCAGGTGAAYCGGACAGCRCAGAATGAGACGCAGGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37625
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 2433 3664 55 80
Genomic Location (Zv9):
Chromosome 23 (position 9714961)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9673102
GRCz11 23 9608072
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTGAGCTCACACTCAGACTCGTGCATGCTCTCGTCTCTGTCAGGATTA[T/A]GAGCATCTGGCCGCTCAGCTGGACGGAGCGAGACAGCCCCTAGCTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18231
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 2563 3664 57 80
Genomic Location (Zv9):
Chromosome 23 (position 9711304)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9669445
GRCz11 23 9604415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCACTGAGCTTTTGAAGTCAGCGGAAGAAYTCAACAACAGCAGTCAGA[G/A]TAAGAAGAGCCAACWCTGGATCTGACTGCCTTATTTTGAATGCTATCATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3245
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 2655 3664 59 80
Genomic Location (Zv9):
Chromosome 23 (position 9709111)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9667252
GRCz11 23 9602222
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGGCAGAAGCAGTACGGAGACTCCAACGCCACTAGTGAGGATATCAAC[A/T]AARCCCTCAATGACGCCAACACATCAGGTGCGTGCAGTGAGCCCTTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43918
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 2700 3664 60 80
Genomic Location (Zv9):
Chromosome 23 (position 9708899)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9667040
GRCz11 23 9602010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCACGTTTCAGCCGTCCAACATCTCCGACAGCATCCAGAGGATTCGT[C/T]AACTCATTGAGCAAGCACGCAATGCTGCCAACAAGGTGCCAACTAAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43917
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 2905 3664 64 80
Genomic Location (Zv9):
Chromosome 23 (position 9699890)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9658031
GRCz11 23 9593001
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGCTGCTCAGTATAAATGAAGAGCTAATCAGCCTCTATAACTTTGAG[C/T]AAACTTTCGACATGAACACCACAACTGATGCACCATGTTCACGGTCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24259
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 2975 3664 66 80
Genomic Location (Zv9):
Chromosome 23 (position 9697861)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9656002
GRCz11 23 9590972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATACACGTTATCGTTTATTAATGTCATTTTTTTCTCTGTCTCTTAGGAT[A/T]AATACGTGACCATCGCTGTTCTTGATGGCTTTCTGAGGGTCTTTTATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29878
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Essential Splice Site 3014 3664 67 80
Genomic Location (Zv9):
Chromosome 23 (position 9697640)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9655781
GRCz11 23 9590751
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAAGTTCAATTGATTTTATGGAATTATTCATTGTGTTTTTTTTTTTC[A/G]GTTGCAAGTCATCCTTCAACTTAACAACATGAAAATGCTTGTGAGGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6725
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 3019 3664 67 80
Genomic Location (Zv9):
Chromosome 23 (position 9697623)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9655764
GRCz11 23 9590734
KASP Assay ID:
554-4602.1 (used for ordering genotyping assays)
KASP Sequence:
TTTATGGAMTTATTCATTGTGTTTTTTTTTTTCAGTTGCAAGTCATCCTT[C/T]AACTTAAYAACATGAAAATGCTTGTGAGGCTGGATCGTGAGACGTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16872
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 3100 3664 68 80
Genomic Location (Zv9):
Chromosome 23 (position 9694958)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9653099
GRCz11 23 9588069
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTTTGTTCAGATAAAGACCATGAAGAGTTCAGGCATCAGCTTTGGCTG[T/A]CCAGATGACCTGCTGGTGAGAGATTACACTTTNATTCACTTGTGCTGATKC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13881
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045126 Nonsense 3200 3664 71 80
Genomic Location (Zv9):
Chromosome 23 (position 9690131)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9648272
GRCz11 23 9583242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTCTKTGAGTTTCTAWACARTTTTGTCTTTGTTTAGGTTGAGCATTTA[T/A]ATAGAYGATGTGCTCGAGAGTTCTGGAGAAACTGGTAATGTAACCACKAG
Associated Phenotype:
Not determined