Busch Lab

ZMP

shq1

Ensembl ID:
ENSDARG00000058522
ZFIN ID:
ZDB-GENE-070112-1412
Description:
Protein SHQ1 homolog [Source:UniProtKB/Swiss-Prot;Acc:A1L1R0]
Human Orthologue:
SHQ1
Human Description:
SHQ1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25543]
Mouse Orthologue:
Shq1
Mouse Description:
SHQ1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919421]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11709 Essential Splice Site Available for shipment Available now
sa26812 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11709
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035513 Essential Splice Site 48 586 2 12
Genomic Location (Zv9):
Chromosome 6 (position 44090468)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44161632
GRCz11 6 44159168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATCCAAGAGRAGGAATTTAAGTTCTATGCCAAGCCCTACTTTCTCAGG[T/C]GACTCTGCAAATGCGWTGATTGACATTTTGTTACAGSAAAAAGCATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26812
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035513 Essential Splice Site 161 586 5 12
Genomic Location (Zv9):
Chromosome 6 (position 44081766)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44152930
GRCz11 6 44150466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAGTACGGCTTTGGAAATCTTAGGTCTGGAGTCTTCAGTAGACTGCAA[G/A]TAAGAACATTTGTCCTTGGTGATAAGGTCTTTTGAAAAAGTTTTTGATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3582
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035513 Nonsense 396 586 12 12
Genomic Location (Zv9):
Chromosome 6 (position 44023922)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 44095086
GRCz11 6 44092622
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTTTTTTNCTCAACYAGATCCAAGCATGTGCTCGCACTAGCMGAACCCT[T/G]AAATAATGCCAAACTCCAGAAGAACCATCTAGAACTGGAGCTGGAGATAA
Associated Phenotype:
Not determined