Busch Lab

ZMP

zgc:173517

Ensembl ID:
ENSDARG00000058507
ZFIN IDs:
ZDB-GENE-070112-222, ZDB-GENE-071004-104
Description:
Zgc:173517 protein [Source:UniProtKB/TrEMBL;Acc:A8E501]
Human Orthologue:
ZNF473
Human Description:
zinc finger protein 473 [Source:HGNC Symbol;Acc:23239]
Mouse Orthologue:
Zfp473
Mouse Description:
zinc finger protein 473 Gene [Source:MGI Symbol;Acc:MGI:2442697]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33096 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33096
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097136 Nonsense 195 210 2 3
ENSDART00000106261 None None 360 None 2
ENSDART00000106266 Nonsense 791 1011 4 6
Genomic Location (Zv9):
Chromosome 3 (position 8716227)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7492805
GRCz11 3 7378645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTGAGAACACATGCGAGGATTCACACCGGAGAGAAACCGTACAAGTG[T/A]TCACACTGCGACAAGAGATTCAGTCAGTCATCACATCTAAAAAAACATGA
Associated Phenotype:
Not determined