Busch Lab

ZMP

dnaja3a

Ensembl ID:
ENSDARG00000058494
ZFIN ID:
ZDB-GENE-030131-7837
Description:
dnaJ homolog subfamily A member 3, mitochondrial [Source:RefSeq peptide;Acc:NP_958470]
Human Orthologue:
DNAJA3
Human Description:
DnaJ (Hsp40) homolog, subfamily A, member 3 [Source:HGNC Symbol;Acc:11808]
Mouse Orthologue:
Dnaja3
Mouse Description:
DnaJ (Hsp40) homolog, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:1933786]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33107 Nonsense Mutation detected in F1 DNA Not yet available
sa33108 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8111
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081367 Essential Splice Site 142 453 4 11
ENSDART00000128838 Essential Splice Site 142 453 4 12

The following transcripts of ENSDARG00000058494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 12961455)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11993680
GRCz11 3 11933880
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCTCCTGCTGGAATACTGAGTTGGTGTTTTTCTCATGTTTCCTCTTCA[G/T]GTTCTCAGTGACGAGGTAAAGAGGAAACAGTACGACACGTACGGTTCTGC
Long Flanking Sequence:
TGTATTCCATAGCAAACATTTGTAACATTTGTTTTTTTAATGAAGTCTTCAAATGTAAACAACTTCCCAAAAAACATTTCATAATGTAAATAAGTTGTCATTTAATAAGAATATGTCAATAAGTCGATTTTGACAAAAATGTCAGATAGAACCTCATAATTCTAATGTGACGATTTGTTATGAAAGCTTACATCAATATAGGATTTCATGTGTTGTATATGGTAAATTTATATAAAATGTAACCCTCTATCAAGCACTCTATTTATTTAGCACCTTTTAATGTTTGAAAATGAACCCTTCAGTGACTCCTTAATGATTTTCTCCTATTCAGATGGCCAAAAAGTATCACCCAGACACTAATAAAGAAGACCCTCAAGCTAAGGAAAAGTTTGCACAGCTAGCGGAAGCCTATGAGGTTTGAAGCGTTGTTGTTGTTTTTCTTGTTAGCAGTGTCTCCTGCTGGAATACTGAGTTGGTGTTTTTCTCATGTTTCCTCTTCA[G/T]GTTCTCAGTGACGAGGTAAAGAGGAAACAGTACGACACGTACGGTTCTGCAGGGTTTGATGCGGGTCGCGCCGGTGCGGGACATCAGCAGTATTGGGGTGGAGGGACCAGCATTGACCCGGAGGAGCTTTTCCGCAAGATTTTTGGCGAGTTTTCTGGCGCTCAGGGCTTTGGGGATTTCAACGCCATCTTCAATCAGCCACAAGAGGTATGAGATGCTTACTTCCAGAGATGACTAGTGGATTTTAATGTAACTGCAAACTGCGGCCAATCCAATTGGTCTATACTTTTGAATATTTAAAAATGTATTTATTTGATTTATTTATTAATTTTGAGTTTGTTCATTATTCATAAGATAATGAGATATAATTATACATTTTTTTGTTATTATTATCGCATTTTTTTAAATGTCCAGAAAATTTGATTTGTTTTTTTTTTTTTTTTTTATAAGTTTTTTAAAAAATATTGTTATTTCCCTTAATTTCCCTGTAATTTATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33107
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081367 Nonsense 300 453 6 11
ENSDART00000128838 Nonsense 300 453 6 12

The following transcripts of ENSDARG00000058494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 12964898)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11997123
GRCz11 3 11937323
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTCATCACATCACCCTGTATCGCCTGTCGAGGGACGGGACAAACCAAA[C/T]AAAGGAAAACCGTCACGGTGCCCGTTCCTGCTGGTGGGTTCACTGGGGTT
Long Flanking Sequence:
CAAAAAACAATGAAAAGGGCCCAAAAAAATCGATGCAGTTCATTTAAATCCATATTTCCGACTGTGAGCGTTTTTTGTGGAAATCGTAAATCTCTAGATTGTGCATAACCCTTGTTGTGTTTGCTAACAGTATGTGATGGAGCTGACATTCGCTCAGGCTGCTAAAGGAGTGAATAAGGAGATCACAGTGAACATCGAGGGCACGTGTCAGCGGTGTGACGGCAGAGGACATGAGCCTGGGTCTAAAGTCCAGCACTGCGGAAATTGTAATGGCACCGGCATGGTGAGTAAGGCTGTCAAAAAACATACTTGTCGAATTTGTGGAAAAAAGACGTATTTGAATACAAAAACCCGTTGTTGAATTGTTGGTGCGTCTGTCACTGTAGGAGACGGTGAACACGGGACCCTTCGTGATGCGCTCCACCTGCCGGCGCTGTGGAGGGAGAGGTTCGGTCATCACATCACCCTGTATCGCCTGTCGAGGGACGGGACAAACCAAA[C/T]AAAGGAAAACCGTCACGGTGCCCGTTCCTGCTGGTGGGTTCACTGGGGTTATCGATGTTGAAGTGAGACTGACTTCAGTGAATGGGATTGTTGAGTTTTGATGTTTTGTTCTCGACTGTTTTACAGGTATTGAGGATGGGCAGACGGTGCGAATGCCTGTTGGGAAGAAAGAGATTTTCATTACGTTCAAAGTGAGTACATTAGTGCATCAACTGAACCTTAACCCGCTTGCAGTTGTAGTGAGGATTTCTGTTGGGTCTTAAAAACTAAAGAAATAAAAAATTATTTCTAAACTAGAAAAATGATAGGCTTCAAAAAGTATTGAATTTACTGAAGCATTGTGTTTCTAGTAGGGAAGCTCAAAATAATCAATTAACCGTTAACCAGAGGGTGCGTTTGTAACCGATTAACGGTATCAGTTAAACGATTAAAAATTATATTTTATATATTTTTAGTTTTGCTGCATAAGGGGCCGATCGAATGCGTTAAGAGGGGCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33108
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081367 Essential Splice Site 447 453 None 11
ENSDART00000128838 Essential Splice Site 447 453 None 12

The following transcripts of ENSDARG00000058494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 12974232)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12006457
GRCz11 3 11946657
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCTTGATCGAGTGGATTTTATAGGTTATTCACTTCTGTTTGTGTTTAC[A/T]GGTAAAAGATCGGCTGGAAACTGAGAGACTTTGCCTTGCTAGTGGAGATT
Long Flanking Sequence:
CTGTCGGCTCACAGCAAGAATGTTGTTGGTTCGAGTCCCGGCTGGGTCAGTAAAACATATGCTGGATAAGTTGGCGGTTCATTTCACTGTGGCGACCCCTGATGAATAAAGACACTAAGCAGAGAAATGAATGTAGGGAAATGAATGAATACTTACCTTTGGCCCACCATCCTCAATCAAGTTTGGTTTTTGGCTCTTCCTAAAAAAACGTTTGGGCACCCCCTGATCTAAATCATTTTAAAGTTTTACTAATATTTTTATTTAGACTTTATTATTATTTATATTTATATTCATTTTGAAATAAAGTAGCTTTTTTATTAGCTTATCTTATAAGAAATGTGTTTATAACAAAAGAGTTGCATCTGAATTCTATATACAAAGTTAAAAATACAAGTTTAAAAATGTTTTGTTTGTTTGCTATCAACTGTATATTATCTCAACTATAATAATCATCTTGATCGAGTGGATTTTATAGGTTATTCACTTCTGTTTGTGTTTAC[A/T]GGTAAAAGATCGGCTGGAAACTGAGAGACTTTGCCTTGCTAGTGGAGATTGAGAATTCACTGCAAACATGATGGACTTACAACACCGGAGTCTAACTCGGTTCCTGGAGAGCTGCAGCTCTGCAGAGTTTAGTTTCAGCCCTGCTTCAGCACACCTATCTGTGGGTATCAAACAAGCCTAAAGCACTCGTTAGTTGGATCAGGTGTGTTAAATTAGGGTTGGAACTAAACTGTGCAGAGCTGCGGCTGTCCAGGAATTGAGTTTGACACCCCTGACTTACAAGAAGTAACATGAACAGCATTGAATTCATCTGGAAAACGCCTCAGATACTACACAGAATGAAGAGCTCTGGACATACAATTGACTTTTAAGAGCAGATCATTGAGGATTTTGATAAACGCACACATGTACACTCTCAGAAATAAAAGTACGCGAGGTGTCACTGGGGTGGTACCTTTTTGAAGGGAACACATTTGTATCCAAAGGGTGAATATTGGTAC
Associated Phenotype:
Not determined