Busch Lab

ZMP

ern2

Ensembl ID:
ENSDARG00000058475
ZFIN ID:
ZDB-GENE-090312-15
Human Orthologue:
ERN2
Human Description:
endoplasmic reticulum to nucleus signaling 2 [Source:HGNC Symbol;Acc:16942]
Mouse Orthologue:
Ern2
Mouse Description:
endoplasmic reticulum (ER) to nucleus signalling 2 Gene [Source:MGI Symbol;Acc:MGI:1349436]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa17230 Essential Splice Site Available for shipment Available now
sa39549 Nonsense Mutation detected in F1 DNA Not yet available
sa12750 Nonsense Available for shipment Available now
sa18038 Nonsense Available for shipment Available now
sa25525 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17230
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081355 Essential Splice Site 91 950 3 24
ENSDART00000143587 Essential Splice Site 95 927 4 22
Genomic Location (Zv9):
Chromosome 1 (position 8264186)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8503991
GRCz11 1 9188102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACGGMAGTCTGTATGTTCTCGGAGGAAAGAGGAAAGAAGGTCTGATGG[T/G]GAGTRTTGTGAGCGTGGCWGYGGATGTGTTTATCAGAGAGTGACAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39549
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081355 Nonsense 187 950 6 24
ENSDART00000143587 Nonsense 191 927 7 22
Genomic Location (Zv9):
Chromosome 1 (position 8262608)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8502413
GRCz11 1 9186524
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGCTGGAATGCCACATACAACGATTACTCAGCTCCTCTATATGACGAC[A/T]AAAAATATGAATATAGTAGGTTCCTCACAATGCATGATTGTAGATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12750
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081355 Nonsense 191 950 6 24
ENSDART00000143587 Nonsense 195 927 7 22
Genomic Location (Zv9):
Chromosome 1 (position 8262594)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8502399
GRCz11 1 9186510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATACAACGATTACTCAGCTCCTCTATATGACGACAAAAAATATGAATA[T/G]AGYAGGYTCCTCACAATGCAYGATTGTAGATATTTACATACAGTTGAGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4830
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081355 Essential Splice Site 192 950 6 24
ENSDART00000143587 Essential Splice Site 196 927 7 22
Genomic Location (Zv9):
Chromosome 1 (position 8262591)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8502396
GRCz11 1 9186507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAACGATTACTCAGCTCCTCTATATGACGACAAAAAATATGAATATAG[T/C]AGGYTCCTCACAATGCAYGATTGTAGATATTTACATACAGTTGAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18038
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081355 Nonsense 691 950 17 24
ENSDART00000143587 Nonsense 668 927 17 22
Genomic Location (Zv9):
Chromosome 1 (position 8253576)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8493381
GRCz11 1 9177492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGATTTAAAGCCCAGGAATATTTTGCTRTCTCTKCCCGGGGMACTGGGT[C/T]GAGTGCGGGCGCTSATCTCAGATTTYGGCTTGTGTAAGAAGCTTCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25525
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081355 Essential Splice Site 895 950 23 24
ENSDART00000143587 Essential Splice Site 871 927 21 22
Genomic Location (Zv9):
Chromosome 1 (position 8248397)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8488202
GRCz11 1 9172313
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATATAAAGGAAACTCAGTGAGAGACCTGCTTAGAGCAATGAGGAATAAA[G/A]TAAGTGTTTAGAGCTTTAATGTGTTTATGCTGCATACAGGTGAATGACTG
Associated Phenotype:
Not determined