Busch Lab

ZMP

rpl6

Ensembl ID:
ENSDARG00000058451
ZFIN ID:
ZDB-GENE-030131-8671
Description:
60S ribosomal protein L6 [Source:RefSeq peptide;Acc:NP_001003844]
Human Orthologue:
RPL6
Human Description:
ribosomal protein L6 [Source:HGNC Symbol;Acc:10362]
Mouse Orthologues:
AC124399.1, Gm6807, Rpl6
Mouse Descriptions:
predicted gene 6807 Gene [Source:MGI Symbol;Acc:MGI:3649145]
ribosomal protein L6 Gene [Source:MGI Symbol;Acc:MGI:108057]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5461
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101125 Essential Splice Site None 265 1 7
ENSDART00000125124 None None 265 None 7
Genomic Location (Zv9):
Chromosome 8 (position 2681304)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2447693
GRCz11 8 2506236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGTTTTCTCCACACACAATCTGCATTAATCTCACTCATCATCGCGTTG[T/C]ATGTCAATCTATATCGTATTTAAATGCTTTAAAATAYTCATAGCGCTAAT
Associated Phenotype:
Not determined