Busch Lab

ZMP

rab35

Ensembl ID:
ENSDARG00000058425
ZFIN ID:
ZDB-GENE-040801-62
Description:
RAB35, member RAS oncogene family [Source:RefSeq peptide;Acc:NP_001003548]
Human Orthologue:
RAB35
Human Description:
RAB35, member RAS oncogene family [Source:HGNC Symbol;Acc:9774]
Mouse Orthologue:
Rab35
Mouse Description:
RAB35, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1924657]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12956 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12956
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033152 Essential Splice Site 34 201 2 6
Genomic Location (Zv9):
Chromosome 8 (position 3854802)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3600830
GRCz11 8 3659579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTGGAAAGAGCAGTCTTCTYCTGCGTTTCGCCGACAACAYATTTTCAG[G/A]TAAGTCAAAATTATAAAACTTNNTTTTTTTTATTMATTTTTTACATTTTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1858
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033152 Essential Splice Site 76 201 3 6
Genomic Location (Zv9):
Chromosome 8 (position 3855310)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3601338
GRCz11 8 3660087
KASP Assay ID:
554-1849.1 (used for ordering genotyping assays)
KASP Sequence:
CAGATATGGGACACAGCCGGACAAGAGCGATTCMGAACGATTACATCTAC[G/A]TGAGTCAAACGCATGACACGAACRAACTGATGCTGAGCTGCTGAATGAYT
Associated Phenotype:
Not determined