Busch Lab

ZMP

gcn1l1

Ensembl ID:
ENSDARG00000058419
ZFIN ID:
ZDB-GENE-040724-264
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B5DE37]
Human Orthologue:
GCN1L1
Human Description:
GCN1 general control of amino-acid synthesis 1-like 1 (yeast) [Source:HGNC Symbol;Acc:4199]
Mouse Orthologue:
Gcn1l1
Mouse Description:
GCN1 general control of amino-acid synthesis 1-like 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:244424

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa6092 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21180 Essential Splice Site Available for shipment Available now
sa34283 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27126
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081272 Essential Splice Site 564 2669 17 61
Genomic Location (Zv9):
Chromosome 8 (position 3758554)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3505037
GRCz11 8 3563786
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGACTGTTCCTGGATCAGCCACAAAGACTCAACAACAGCAAGTCTCAG[T/G]GAGTCACTGAAGTCTTTTATTTACGCGATCATTTTTAAGAGGTGATTTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3672
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081272 Essential Splice Site 722 2669 20 61
ENSDART00000081272 Essential Splice Site 722 2669 20 61
Genomic Location (Zv9):
Chromosome 8 (position 3762834)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3509317
GRCz11 8 3568066
KASP Assay ID:
2260-0064.1 (used for ordering genotyping assays)
KASP Sequence:
CCTGGAAGTGATTCTACCTCGCCTGCTGGAAGCCAACACAGACAATCAGG[T/A]GCGTTAAAATGTCCCATTGGCATTAGTAATGTTGGACAYATTTCAGATTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8368
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081272 Essential Splice Site 722 2669 20 61
ENSDART00000081272 Essential Splice Site 722 2669 20 61
Genomic Location (Zv9):
Chromosome 8 (position 3762834)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3509317
GRCz11 8 3568066
KASP Assay ID:
2260-0064.1 (used for ordering genotyping assays)
KASP Sequence:
YCTGGAAGTGATTCTACCTCGYCTGCTGGAAGCCAACACAGACAATCAGG[T/A]GCGTTAAAATGTCCCATTGGCATTAGTAATGTTGGACAYATTTCAGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6092
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081272 Essential Splice Site 851 2669 23 61
Genomic Location (Zv9):
Chromosome 8 (position 3766384)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3512867
GRCz11 8 3571616
KASP Assay ID:
554-3859.1 (used for ordering genotyping assays)
KASP Sequence:
TGCAGATCCAGCTGGAGAAAGAGTCTACTATCCGCAAGCGTCTGCAGGAG[G/A]TGAGAGCTCATACAGCAGCAGCAGTGATGGTCTGAGCTGCGCTGATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21180
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081272 Essential Splice Site 851 2669 23 61
Genomic Location (Zv9):
Chromosome 8 (position 3766385)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3512868
GRCz11 8 3571617
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGATCCAGCTGGAGAAAGAGTCTACTATCCGCAAGCGTCTGCAGGAGG[T/C]GAGAGCTCATACAGCAGCAGCAGTGATGGTCTGAGCTGCGCTGATCAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27127
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081272 Essential Splice Site 1205 2669 30 61
Genomic Location (Zv9):
Chromosome 8 (position 3782393)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3528876
GRCz11 8 3587625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGACTGTCCTCTCACAGCTCACTCAACTCTACCATCAGAAGCTATATG[T/A]AAGGCTCTCTCTCGCTCACACACACACACACACACACACACAAACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34283
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081272 Nonsense 1650 2669 39 61
Genomic Location (Zv9):
Chromosome 8 (position 3796715)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3543697
GRCz11 8 3602446
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTCATAGATTTACTGTGTGTATGCGTTTTCAGGATCTGTCTCCGTATT[T/A]GCCCAGTGTGATTCCAGGCCTCAAAGCATCTCTGCTGGACCCTGTGCCAG
Associated Phenotype:
Not determined