Busch Lab

ZMP

adcy2a

Ensembl ID:
ENSDARG00000058392
ZFIN ID:
ZDB-GENE-061109-1
Human Orthologue:
ADCY2
Human Description:
adenylate cyclase 2 (brain) [Source:HGNC Symbol;Acc:233]
Mouse Orthologue:
Adcy2
Mouse Description:
adenylate cyclase 2 Gene [Source:MGI Symbol;Acc:MGI:99676]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36048 Nonsense Mutation detected in F1 DNA Not yet available
sa36047 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36048
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084264 Nonsense 483 1155 9 25
Genomic Location (Zv9):
Chromosome 16 (position 10627528)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9409237
GRCz11 16 9300139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTGTATGGTGAGTAGATCAATAGTAATTGCAAGTTCTTGATGAACAGA[C/T]GAGTCCACATTACCTCAGAGACTCTTGAACACTTGAACGGAGCATACAAG
Long Flanking Sequence:
GAAATGACCTTATTTTAACATAGTCAGTCGTGAACTGAGGTAGGCTGGTCTAATGCTAAACCTCCAGGGCTAAAAAGGAATCCCACTCCGGCCCTGGGTGCACGGGTCATTTTTGACCTGTAAGTCAACAGGATTTTTCTTTTAATGGAACTCAATAAGGTTAAATTGATGCTCTGATGTGTAAAGGGATGTTTTGTTGTTTCCTTCTACCTTTTCTACACAGGAAAGTCCGAGATGCCACAGGAGTGGAAATTAGCATGCGAGTTGGTGTTCACTCTGGTAACGTTCTCTGCGGTGTAATTGGCCTCCAAAAATGGCAATATGACGTCTGGTCACATGATGTAACTTTAGCCAATCACATGGAAGCAGGTGGTGTACCAGGGTAAGTCACTGTGGGTTTTTAATAATTATTTTCAATTATTAATCATGATATGCTTTTTGTTTGTGGAGTACTGTATGGTGAGTAGATCAATAGTAATTGCAAGTTCTTGATGAACAGA[C/T]GAGTCCACATTACCTCAGAGACTCTTGAACACTTGAACGGAGCATACAAGGTTGAAGATGGACATGGCCAGGAACGTGATCCTTATCTAAAAGAACATGGAGTTATAACCTACTTAGTGATCAACCCAAAGGTATGAAAAACAAGTTAGCAGTCTTTATATGTTTCTTTATGTTCTAAAATGTCTTTATAGTCTAAAATTCTTAAATTCAAGCCCTTGTTGGGCTGTTATCTTACCTCTGGCTTTAATATATTTTTTTAGGCTAAGTTGACCAAGGAACTTACTAAACAAAACTGAGGTGGTTTGGTGATGGATGTTTTGATTGTTCTTTTCTGTTTTGTTTTTAGGTAGAGAGAAAGAGTCCTCAGCACTACTACAGACCAAGACATACCATTGACGGGGCTAAAATGAGAGCTTCAGTGAGGATGACCAGATACCTGGAGTCCTGGGGTGCGGCCAAGCCTTTCGCCAACCTTCACCACAGAGACAGCATGACCAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28586
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084264 Essential Splice Site 600 1155 11 25
Genomic Location (Zv9):
Chromosome 16 (position 10625517)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9407226
GRCz11 16 9298128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACAGGATGTGCCCATAGGCCAGTACCACTTTCAGAGACGTTCAGAAAG[G/C]TGATTTAATTTCTGTACTTTTTTTCTAGTTATGCTACAATACATACCGTA
Long Flanking Sequence:
AAGAGACAAACGCATGGATGAAAGTCTTAGCATCCTTGCTACTGATGAAGGGATGAGGTTGGGAAATACGACAGTCTGTCACTGTGCTGTTTATCTGACGCAGCAGGAGGCACATGGGAAAGGTGGGCGGGGAGAACTGGCTCATTTGCATTGAAGGCACAGGCAACAAAAAACGATACAATGTGCTCTGAGCTAAAATTGCAATATTCAGAAAAGTATCATATATAATTTGATGGGTATTTTGAGCAGAAACTTTACTGACACATTCTGGAGACACAAAAGACTTATCTTAAATCTTAAAAAAGGGGTAAAATAGGTGCCCTTTAATTATGATTAGAACATTGTAGCTGAAGTTATACCTTTTGATAAAAGTATGTACACATGGTGTTTTGTTTTTGTAGCATTTACTATTTGTTTGAGAATATTACTTACCACTTACTTCTGCTTTATTAACAGGATGTGCCCATAGGCCAGTACCACTTTCAGAGACGTTCAGAAAG[G/C]TGATTTAATTTCTGTACTTTTTTTCTAGTTATGCTACAATACATACCGTATTTGCAAAAATTGTCACTGGGGAATAAAACACAGTATCAACATATATACAACATGGAAAATAATAACTAGTTTAAATAGTAAAGACATTTTAAACATTAAGGAATTCATAACAAAATCACTAATAAGTCAGTGTCCTCCTCAGAACAAAATCTCAGAAGAAGCGGTTTGAGGAAGAGCTGAATGAGAGGATGATTAGAACATTTGATGGCATCAACTCTCAAAAGTAGGTCGCCTTTTATATGTATAAGTTATGGTTTAGTATTTTTCTGGTGAGTACTTATGTTTGTGTTATTATTATTATTTCTATAGACAATGGCTGAAATCAGAAGACATTCAAAGAATATCTTTGTTTTTCCATAATAAAGCTTTGGAAAAAGAGGTAAGCACTGACACTTTGCAAACCAACTTAAACAGAACGTTTGAATAATAATGCATAAACGTATAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36047
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084264 Nonsense 898 1155 20 25
Genomic Location (Zv9):
Chromosome 16 (position 10610217)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9391926
GRCz11 16 9282828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTCCTCTTGTAACAGAATGAATATTACTGTAGGTTGGACTTCCTGT[G/A]GAAGAACAAGTTCAAGAAGGAATGTGAGGAGATAGAGACCATGGAAAATC
Long Flanking Sequence:
CAGATGATTATTTGAGTCATTGCAGAGATGTATGGATGCAATTGTCCAAGTTCTCGGGAGTCATACACACTGTTAATAATTTATTTACCACTGCACCATGTCTTTATATTCTATACTGTAAATTATGTATGACAAGACTTTGGTTTAAGCAAAGTCAGACCTTACTGTCCTAATTTAATCATTAAAATTAAGGCGTGATCATATTTTATTTTGGTAAAATAAGTGTATTCTAGAGGTCTTTGCATTTTATATAAGACACTTCTGATACAAAATGATCAACTAGAAGTCAAGTTATTATTTGTTATTCCGAAAAACTTGAATAGGCGACAAGACTTTGGTCAGATAGTGTATGTACATGTATGTACAGTATATGTTGACAGCAGGTATCTTTCTTAATTATCTTGATTTGTTCTGATTGAAATAGCATTGTGTCCTCCAGTATCTTGACCTTTGTGTCCTCTTGTAACAGAATGAATATTACTGTAGGTTGGACTTCCTGT[G/A]GAAGAACAAGTTCAAGAAGGAATGTGAGGAGATAGAGACCATGGAAAATCTCAATCGGGTTCTGCTGGAGAATGTTCTACCAGCGCATGTAGCCGAGCACTTCCTGGCCAGAAACTGGAAGAATGAGGTAAAAAAAAAATAAAAAATAGGTAGAAAAGGAGCAACCTAAGTTGTAGAGCTCTACTGAAATTTGTATGAATCCTACATTCATAACATGTTAAAAATTGTGAGATTCTTTACATTATTTCATTTGTTTTGGACATGTTCCAAACTTAAAACCTATTGGAGAAATATAATACAAACTATAAGTAAAATTGCCAATGTTAACCTTTTACCTGATCCAAGATTTATGTTGTTGGGGGATGAATCAGTTCTTCTGTTCGATCAAAGGAAAAATTTACGTTTAATTAAAATGGCTCTGATAGCAGCAAAGAAATGCATTGCTGCACATTGGAAATCAGTAGAACCACCAAGTCATATTGTATGGCTTAGAGAACTTT
Associated Phenotype:
Not determined