Busch Lab

ZMP

zgc:123262

Ensembl ID:
ENSDARG00000058390
ZFIN ID:
ZDB-GENE-051113-136
Description:
acyl-CoA thioesterase like [Source:RefSeq peptide;Acc:NP_001032476]
Human Orthologue:
ACOT9
Human Description:
acyl-CoA thioesterase 9 [Source:HGNC Symbol;Acc:17152]
Mouse Orthologues:
Acot10, Acot9
Mouse Descriptions:
acyl-CoA thioesterase 10 Gene [Source:MGI Symbol;Acc:MGI:1928940]
acyl-CoA thioesterase 9 Gene [Source:MGI Symbol;Acc:MGI:1928939]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44135 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37888 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44135
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058948 Essential Splice Site 5 425 1 15
Genomic Location (Zv9):
Chromosome 24 (position 22559790)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21806668
GRCz11 24 21951842
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGTTCCCCAAGCGGCAAGGGAAGAATAAAAAGATGTTTTGTCCACGG[T/G]GAGTGTTAAATAGACATTTTCCGATTTTGTTTTAATCTGTAAGGCTACTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30095
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058948 Essential Splice Site 119 425 5 15
Genomic Location (Zv9):
Chromosome 24 (position 22553991)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21800869
GRCz11 24 21946043
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCTTCAAAGGTTTGGACGGATTTTGGAGGACTTGGACTGCTTAGGAG[G/A]TACTACAGATGTTTCTCCAATAATGTATTCTGCTCCAGAAGTAAAAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37888
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058948 Nonsense 259 425 10 15
Genomic Location (Zv9):
Chromosome 24 (position 22550716)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21797594
GRCz11 24 21942768
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTTCTGAAAGTGGCTCCTACAGCAGAGGAGAGGACACTCATTCACAAC[C/T]AGTTCCTCAACACTCTTGACACACGGTCCATTTATGAGCATTACACAGAT
Associated Phenotype:
Not determined