Busch Lab

ZMP

scinlb

Ensembl ID:
ENSDARG00000058348
ZFIN ID:
ZDB-GENE-040426-2068
Description:
scinderin like b [Source:RefSeq peptide;Acc:NP_998255]
Human Orthologue:
SCIN
Human Description:
scinderin [Source:HGNC Symbol;Acc:21695]
Mouse Orthologue:
Scin
Mouse Description:
scinderin Gene [Source:MGI Symbol;Acc:MGI:1306794]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa19686 Nonsense Available for shipment Available now
sa32850 Nonsense Mutation detected in F1 DNA Not yet available
sa25764 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45090 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19686
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Nonsense 169 720 5 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10220415)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10645511
GRCz11 2 10429110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAATATGTTTTAGTCATTCTTTTTGTTTTTTTCCCTCAGGATATTTA[T/G]CAGTGGTGTGGCAGTGGCTGCAACCGATTTGAGCGTCTGAAAGCCTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32850
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Nonsense 178 720 5 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10220390)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10645486
GRCz11 2 10429085
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTTTTCCCTCAGGATATTTATCAGTGGTGTGGCAGTGGCTGCAAC[C/T]GATTTGAGCGTCTGAAAGCCTCCAAGCTGGCTATTGATATCCGGGACAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3403
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Essential Splice Site 216 720 None 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10220272)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10645368
GRCz11 2 10428967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAGCTGGTCATGGTGGAGGAGGACGCTGAACCAGACGCCCTGATTCAAG[T/G]CAGTCAAGTTTAAGCTCTACTTCTCCTTTAACAATTTCCACACAACCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25764
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Essential Splice Site 290 720 7 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10215316)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10640412
GRCz11 2 10424011
KASP Assay ID:
2259-1626.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCTACATCCTAGACAATGGAGTCGACAACAATGTGTTTGTGTGGAAAG[G/A]TGCGTCGCATGTGTGTTCATTTTAAAATCAGCATGGAATCACGATTGGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25763
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Nonsense 317 720 8 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10212618)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10637714
GRCz11 2 10421313
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCCATGAGTGCAGCGGAGCAGTTCATCAAAGAGAAGAACTACTCC[A/T]AAAAAACAATGGTATAAACAGTACAACACAGACACTTTAAACACTTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45090
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Nonsense 437 720 11 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10207259)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10632355
GRCz11 2 10415954
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATCTGTGGTGTGTTTGCAGCATGTGAACAGAGTGTGATTGTGTTTCAG[G/A]CAGGGGCTGAAGTGCACTCAGGACGAGCTGGCAGCTTCTGCTTTCCTCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa453
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081196 Essential Splice Site 583 720 13 17

The following transcripts of ENSDARG00000058348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 10196032)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10621128
GRCz11 2 10404727
KASP Assay ID:
554-0381.1 (used for ordering genotyping assays)
KASP Sequence:
AGTGTGCTTGGAGGACAATCCACAGATGTGCCAGAGGGTAAAGAACCAGG[T/C]GAGTGTCGGGACAGGTTTTTATGTGTTTTATGTATATGGTGAACTTGTTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461