Busch Lab

ZMP

C11orf53 (2 of 2)

Ensembl ID:
ENSDARG00000058254
Description:
chromosome 11 open reading frame 53 [Source:HGNC Symbol;Acc:30527]
Human Orthologue:
C11orf53
Human Description:
chromosome 11 open reading frame 53 [Source:HGNC Symbol;Acc:30527]
Mouse Orthologue:
1810046K07Rik
Mouse Description:
RIKEN cDNA 1810046K07 gene Gene [Source:MGI Symbol;Acc:MGI:1917059]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42519 Nonsense Mutation detected in F1 DNA Not yet available
sa17449 Nonsense Available for shipment Available now
sa2816 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa42519
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081105 Nonsense 110 282 4 5
Genomic Location (Zv9):
Chromosome 15 (position 16762947)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17807910
GRCz11 15 17743932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGATAGCGGATGCGTGGCTGGTTATTCGTCTCTCATAGACAGCTACTA[T/A]CCTGAGTCTTTTGGAGATTATCGCAGCACTCCTTTCTCTAGTGGAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17449
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081105 Nonsense 196 282 5 5
Genomic Location (Zv9):
Chromosome 15 (position 16766529)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17811492
GRCz11 15 17747514
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTTCTCTGGTGAAWCCTGAATCCACCAGCCCAACACAGTTCCGCTCGT[C/G]RTCCCGAGGGTCCAGCATGGYRTCCTCACAGTCCTAYTCTCTACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2816
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081105 Nonsense 273 282 5 5
Genomic Location (Zv9):
Chromosome 15 (position 16766761)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17811724
GRCz11 15 17747746
KASP Assay ID:
554-3193.1 (used for ordering genotyping assays)
KASP Sequence:
GCCCTGAGCGACGGTCTRGTATGGGGCAAAGAGGACACAGGCAGCAYATG[G/A]CCACAGTATGAGGTCAGGAGGGCATTCTGATATAKTCAGCTGTGAGGATA
Associated Phenotype:
Not determined