Busch Lab

ZMP

si:dkeyp-77h1.4

Ensembl ID:
ENSDARG00000058248
ZFIN ID:
ZDB-GENE-050208-18
Description:
Im:6912380 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZQ8]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14654 Nonsense Available for shipment Available now
sa8837 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14654
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081092 Nonsense 137 416 2 5
Genomic Location (Zv9):
Chromosome 16 (position 11973782)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10473448
GRCz11 16 10364350
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGRTCTTTAGTCCGCCTGAACTACACCCCTGAGTCCGATAAGCTCAAGTA[T/G]TTGATWATGGAGAGCGGAGAGCTCAGTGTGCCTCCTAACCTGGACCTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8837
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081092 Nonsense 197 416 3 5
Genomic Location (Zv9):
Chromosome 16 (position 11974057)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10473723
GRCz11 16 10364625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGATGTTTTGGACTTACTGATGYATCTCCCTCTCTTATTTCTCAGCCTA[C/A]AGTATTCCAAGACTGTACATTGCCATCATCGCTCTGGTAGCATTATTGGT
Associated Phenotype:
Not determined