Busch Lab

ZMP

zgc:172129

Ensembl ID:
ENSDARG00000058243
ZFIN ID:
ZDB-GENE-080220-4
Description:
hypothetical protein LOC556928 [Source:RefSeq peptide;Acc:NP_001107883]
Human Orthologue:
PHACTR3
Human Description:
phosphatase and actin regulator 3 [Source:HGNC Symbol;Acc:15833]
Mouse Orthologue:
Phactr3
Mouse Description:
phosphatase and actin regulator 3 Gene [Source:MGI Symbol;Acc:MGI:1921439]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa3239 Essential Splice Site F2 line generated Not yet available
sa43924 Nonsense Mutation detected in F1 DNA Not yet available
sa37637 Essential Splice Site Available for shipment Available now
sa12783 Nonsense Available for shipment Available now
sa37636 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29888
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Nonsense 9 498 1 12
ENSDART00000133956 Nonsense 36 525 1 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12451849)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12410651
GRCz11 23 12345621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTATTTGACTCACACAAGCTCCTCATGGCTACATCGGACGGAATAGAC[A/T]AATGTCTTCTGCACAGAGGCAGATCTCAAAGTGACCCGAACATCCTCAGC
Long Flanking Sequence:
AGGCGAAAATACGAGTCATCATGATTCATTCATCTCAAAAACCCTGATTCTCTCCGAATCAACGCCACTAGAAGGTCTGCAAAAGCCCAAATGAATGGATTCATTTACGAAGGCGCTGTAAAACGTCATGCGCTCGCATCCTGTGATTCAGAACGGATGCTCGCCTGTCAGTGGGTCATTGTGGAGTGGATAAAGGTGGCATCTGCGCGCGCGCGTACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACAAATACCCCAGCCTTATGACAGACACTCTCGGTCTCCCTCCCTCATGCACACACACAGTGACTGTAAAGGGTTCCTCTAATTCGGCAATGCCTGCTGCTGGATGCTCTTAGACGCATCCGCCTCACCGACGGCTCCGCTGCCTCCGAAAGGGATTTCATTATTTGACTCACACAAGCTCCTCATGGCTACATCGGACGGAATAGAC[A/T]AATGTCTTCTGCACAGAGGCAGATCTCAAAGTGACCCGAACATCCTCAGCGAGTCTGGCATCGATCTCTCGCACGGCGCAGGTAAGATGATGCATTTATTGTCTGGAGATGCCATTAGGAAAAAATAAAAGCGCTTTTCACTGCCACGGTGAAAGTGGTTCCACCATCTGCGCTTTCGTTTTAATATTAGGCGCCGCGCGATGGAGATCAATTAAATTACGTCGCCTTTGATGCATACCCCTTGAAATGCATCTGGAAAATAACACCATAGTAATATTTCCCCCTGCGGATCTGTGTTTTTGGTTGCTACAACGAGCAGGAGGAGAGATCATAGCAGACTACCTAGAGATTATGTGCCAACTGTGGCTTATGCTACCATTCAAAATGAGCAGACAAAAAGGTTTATATCCTATGTTAGATTTTTTTTTTGTTCTCCAGTGAGGGAGGGTTCATCCGCGTTATTGTCTTTTGTCTCGTGTGCACTTGTTTCTGCGCGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3239
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Essential Splice Site 90 498 2 12
ENSDART00000133956 Essential Splice Site 117 525 2 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12384727)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12343529
GRCz11 23 12278499
KASP Assay ID:
554-3383.1 (used for ordering genotyping assays)
KASP Sequence:
TGGAAATGGAGGAAAAAGAAAAACGAGAAGCTGAAACAGAGCTCTACAGG[T/A]AAGAAAATATGGTTGTTTTATAATTTGTTTAGTGCATTGAACTGAAAATG
Long Flanking Sequence:
CCAATAAAACAGTCATATAAAATAAACCATACCTACTAATATATTGAAGTATTTAAATTGCTCCTAAAACAGCTTGGGTCCATGTGCTCTTTAAAGTTCACCTAAATTCCTCCATATTGATGATTAATGTGTCACCATCTGTATTCTAATCTGCTTTGCGCAGTTGTAAATGAGCAGGATGGGCTTTCGGCAAATAAATCCACTGAAACATGGCCTCAATCAGATTAAATTCTCCTCTAAATGAAGCAGCCAGTTTCAGCCTCATGGACCTCACTAGATCTGTTTAATATTAGGAGTAAAGCACTGATGTTTCTTGTCTGTGCTGTGTTTTTCACAGATGTGATTGAGCAGCAGAAGGTGCTGCGCTCCAGCTGTTTAGTAAGTGGAGTCCACACTCCTCCCATCCGCCGCCACAGCAAACTGGCAACACTGGGACGCATCTTCAGGCCATGGAAATGGAGGAAAAAGAAAAACGAGAAGCTGAAACAGAGCTCTACAGG[T/A]AAGAAAATATGGTTGTTTTATAATTTGTTTAGTGCATTGAACTGAAAATGTGCTGCTTGTCCATGCAGATGAATCTGCAAAGATGTGTTTGAATTATTTTATCTAAAATGGCTTCATAGTGTTTAATATTGAAATAAAATGAAGATTCAAATTATCAATATAATAATTAAAGCAATAAAATGTGCATAAATAAATCAAAATTTTAATCGACAATTGAGGGACAAATAAATAGACATATTTAAATGTGTTTAATCAAAAGTTAAAAAAAATGTAATTGGACATTCCACACGTGGGAGCAACCAATCAAATTTTGCTTCAAGTCAAGCTAAACCCTCTCGCTTGTAAATGAAACGTGCACTGTCATTGGACAGAGAGAAACCATAGCTCATTTTAGCAGGAGTTTAAAGATCAGCAAAGAGACTCAAATGTCAGGTATTTATTAACTAGCTGATTACTGTAAAAGTAGTTCACATCTGGATTATCACTGTATAGAAAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43924
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Nonsense 147 498 4 12
ENSDART00000133956 Nonsense 174 525 4 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12369344)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12328146
GRCz11 23 12263116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACTTTCCTCACCTGCAATTTTGTGTTTCCTTTAGTGGTAGATTCCTTA[C/T]AGGACACAGAGCCGACAGAAGACCCAAAATCAAATGAAGAAGAGGGGGAC
Long Flanking Sequence:
ATTCATTTATTCATTCATTTTCCTTTCAGCTTAGTCCCTTTATTATTCTGGGGTCACCAAAGTGGAATGAACTGACCAACTTATCCAGCATATGTTTTACACAGTGGATACCCTTCCAGCTGCAACCCATCAGTGGAAAACATCCATACACATTCATTCACACACACATACACTACGAAAAATTTTACTTAACCAGTTCACCTATACTGCATGTCTTTAGACTTGTGGGGGAAACCAGAGCACCCAGAGGAAACCCAAGCAAACACGGAGAGAACATGCAATTTCTACACAGAAAAGCCAGCTGACCCAGCCAAGGCTTGAACCAGCAACATTCTTGCTATGAGGCGATAACTGCCCCACTGACACCCTTTATTTACTATTTTTTTCTAACCCCCTTGAATCCTTTACAAATACACAATATACAGAGTTATCAATAAATTTCAGCCTAAACTACTTTCCTCACCTGCAATTTTGTGTTTCCTTTAGTGGTAGATTCCTTA[C/T]AGGACACAGAGCCGACAGAAGACCCAAAATCAAATGAAGAAGAGGGGGACGAGGAGGAGGCCGTTCTCTCTGTGAATGAGAATGAAGACGTTGAGGAAGATGAAGAAGACCAAGAGGAAGATGAAGAGGATGAAGAGCAGGAGCAGTCTCCACCAAACAGCCATGGCAATCTGGTCTCTCAGCTCAGCACTGAGGAAGGTCTGTTCATCTCTGCGTAATCAAAAATAGGCACGGCTTACTTTTTTTTTTTTACCTCACAAAAGTTCTCTTGGAGATTTTTTGTATGATTACAGTTCAAACATACTAAATATTTTAACAATGTTTTTGGTCCATTTTTGGGGGGGACTATTGGAAACATCTTGTGACCATTGCTGTTTGTGGAGGATGAAGGAGCTCTTAGATTTCTTAGACTCCATTACACTCAAAAATGACTTTTACTGTTTGTTCAAACTACTTATTTAAAATAAGCTGTATCTGCAACTTAATTGTTTTATGTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37637
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Essential Splice Site 213 498 4 12
ENSDART00000133956 Essential Splice Site 240 525 4 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12369144)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12327946
GRCz11 23 12262916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCAAACAGCCATGGCAATCTGGTCTCTCAGCTCAGCACTGAGGAAGG[T/A]CTGTTCATCTCTGCGTAATCAAAAATAGGCACGGCTTACTTTTTTTTTTT
Long Flanking Sequence:
CCTATACTGCATGTCTTTAGACTTGTGGGGGAAACCAGAGCACCCAGAGGAAACCCAAGCAAACACGGAGAGAACATGCAATTTCTACACAGAAAAGCCAGCTGACCCAGCCAAGGCTTGAACCAGCAACATTCTTGCTATGAGGCGATAACTGCCCCACTGACACCCTTTATTTACTATTTTTTTCTAACCCCCTTGAATCCTTTACAAATACACAATATACAGAGTTATCAATAAATTTCAGCCTAAACTACTTTCCTCACCTGCAATTTTGTGTTTCCTTTAGTGGTAGATTCCTTACAGGACACAGAGCCGACAGAAGACCCAAAATCAAATGAAGAAGAGGGGGACGAGGAGGAGGCCGTTCTCTCTGTGAATGAGAATGAAGACGTTGAGGAAGATGAAGAAGACCAAGAGGAAGATGAAGAGGATGAAGAGCAGGAGCAGTCTCCACCAAACAGCCATGGCAATCTGGTCTCTCAGCTCAGCACTGAGGAAGG[T/A]CTGTTCATCTCTGCGTAATCAAAAATAGGCACGGCTTACTTTTTTTTTTTTACCTCACAAAAGTTCTCTTGGAGATTTTTTGTATGATTACAGTTCAAACATACTAAATATTTTAACAATGTTTTTGGTCCATTTTTGGGGGGGACTATTGGAAACATCTTGTGACCATTGCTGTTTGTGGAGGATGAAGGAGCTCTTAGATTTCTTAGACTCCATTACACTCAAAAATGACTTTTACTGTTTGTTCAAACTACTTATTTAAAATAAGCTGTATCTGCAACTTAATTGTTTTATGTTCAATCTTACTTAAATTTGTTAACATGATTAAGTTAACTTAATCGATGTTACACTCAACAAATTTGCATAAAATACTTTAGCTGTTTATTCAAACTACTTATTTAAAATGAGTTACATTTTTTGGGGGGACAACTTAATTGTTTTATGTTCAATGAACTTAAATATTTTAAAACTGAAGTGATTTGTTACACTCAACAAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12783
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Nonsense 319 498 6 12
ENSDART00000133956 Nonsense 346 525 6 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12366730)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12325532
GRCz11 23 12260502
KASP Assay ID:
2261-7413.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAACGTTCGACAGGATCACTGCTTCACTGATGCTTCAGGAATTATCTA[T/A]GATATCGWCAGCTGGAACGACTCTGTCATTTCTGGTGRGTGTAACTGAAC
Long Flanking Sequence:
CACTAATATATTAAACTCAGGTGCTGTCCATTTCTTCTGATCATCCTTTTCTTTACCATGTTTACATATGAAGGTATTGTTTTGTTTCCACAGACGCAGATAAAGTTGTCATCGCATCAGTGCCTCAGTCAAACTCTTTTCTCCAGAAAGAACTGCCTAGAGTCCCTGACGGTCCCAGTCCTGTGGTTCTAAGAGGGCCGTTTTCTGGCTCGCCGCATGTAGGTAGCATACATCCACCGCTGCCCCCTAGCTGTATAATAGAGGAACTGCACCGAGCACTGGCAACAAAGCTCAGGCAGGACAGGTGAGGGTGTTCAATCTTCATTATGTTTTATGCTTGTATGTACGTATTTATCCATTAAAGTGAGCTCATCTTCTCTATGTATTTTTAGCATCGAGCGAGAGCCAAGCGGAGACGGTGAGAGCAGAAAGGAAGCAGAGGAAAACAAGGAAAACGTTCGACAGGATCACTGCTTCACTGATGCTTCAGGAATTATCTA[T/A]GATATCGACAGCTGGAACGACTCTGTCATTTCTGGTGGGTGTAACTGAACAGCTGTTAAAAGTCGCTGTATAATTTGTAAGTTATTATTTATTTGTACACATGTTTTTTTTTTCAAAACTCATCTTGCAATTTTTAGTCAAATTAACTTCTCTAATGATGTGTTTACTGGTGTTAGGGCGGGGTCAGCCTGTCAATTACATGAAATCAGCCAATAGCAAGCCAAAACCATGTGACTGAAGTCCCGCCGTAACATGTTTCCACAAAAGTGCACAAAACATTCCAAAAGTGCTAGTGTGAAAGCACCCTAAGTGATAGAGTAAGGAGGTGGAGTGTTTTTTGTTTCTTTTTTATAGAGTGAAGAGTGTTTCTACAGATGGTTTGTCAAGCCCACTCACATTCATAAATGCACAGGGCATTTGTTTTTTTTAGATATATGGAGTGATATTGAAGTATTGTAAATAACACAATCTCGTTTAAACAGATTCTATTAAATCTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37636
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112341 Essential Splice Site 401 498 None 12
ENSDART00000133956 Essential Splice Site 428 525 None 12

The following transcripts of ENSDARG00000058243 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12347011)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12305813
GRCz11 23 12240783
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTGAGTGACCCGTTTGATTCAATCACTCAGACTTTCTTTGCTCTTTC[A/T]GAGAGGAACGATCAGACGGAACAGGAGGAAAGAAGAGAGATCAAACAGAG
Long Flanking Sequence:
GTTACCACTATGATGTCTATCAGACGTAAATTTTGGTCTCTTTCTAACACAACCTAAAATCAAACAAATATCAACGTAATTTGACGTCATTATTGAACGTCAAAATAATGTTGTCCTTAGACGCTGACTAGATAATGAATTTTGGTCACATAACGTCACAACCTAAATCTAACCTAATTTTAACGTCTTATAATGTTGTGTGCCTGCTGAGAAATATGGTTTACTGATGTTAACAAATGAAACCTTACTGTAAAGGACTACAATTTAAATTCAATGAAGTATTAATTTTTATAACAATGTGACTATGCAATCGATTTCTTAAATCAAAATACTTAATCCTACCGCAGTTTTAGGGCAAAGATGTGATTGTGTTTTCCATTGTGTTCCATTGTGTCGGCACATCAGAGCACATGATGTGAAATAGATATAATCTCTGTGTCAGAAGAGCACACTGTGAGTGACCCGTTTGATTCAATCACTCAGACTTTCTTTGCTCTTTC[A/T]GAGAGGAACGATCAGACGGAACAGGAGGAAAGAAGAGAGATCAAACAGAGACTCAACAGAAAGGTAAACTGCTTTAGCATCACTTTTACTCTTTCTGATTTATGTGTGCTGCTGCTCAATAAAATAAAAATAAAGTTGTTCTGTAAAGTAGGTTAAAACACTGAATAAAAACGAACCGTTTGAAGACAATTGGTGTTTTTCTGAAGGAGAAAACATTAATGTTCTGAACTAGTTGAATCAGATCTATTTAAAGGTCCAGAGCGTAGACACAGAGAAGAAAAGAGCTGAGTTTGCGAAGAGGAAAGCTGGATGTCAGTGCAAGAGATGTAGACAGCAGTATGTCTACGATGATGTGTTTACAAAATAGCAAATACTGTTTATTATTTCAAAATAATAGTAATTAAATATGGCAATATAAAAAACCCCGTCAGTTTCAAATGTGGAAATGTTACTGTTTTTGCTTAGCTCATTCTTCACAGTATATGCAATTAAACGCACAT
Associated Phenotype:
Not determined