Busch Lab

ZMP

fam151a

Ensembl ID:
ENSDARG00000058218
ZFIN ID:
ZDB-GENE-070705-105
Description:
Protein FAM151A [Source:UniProtKB/Swiss-Prot;Acc:A5PN38]
Human Orthologue:
FAM151A
Human Description:
family with sequence similarity 151, member A [Source:HGNC Symbol;Acc:25032]
Mouse Orthologue:
Fam151a
Mouse Description:
family with sequence simliarity 151, member A Gene [Source:MGI Symbol;Acc:MGI:2657115]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa8552 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44522 Nonsense Mutation detected in F1 DNA Not yet available
sa19689 Essential Splice Site Available for shipment Available now
sa31261 Nonsense Available for shipment Available now
sa15963 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8552
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081026 Essential Splice Site 163 599 3 8
Genomic Location (Zv9):
Chromosome 2 (position 10870157)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11295253
GRCz11 2 11078852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACAACACTCTGGAGGAATGGCTGGATGCTGTRCTCAAGTCWAAGAAAG[G/A]TAAACAACATTGTCTGTTTTTCATACTCTGATGACATTGCGAACATTTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44522
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081026 Nonsense 285 599 5 8
Genomic Location (Zv9):
Chromosome 2 (position 10866266)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11291362
GRCz11 2 11074961
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCCTGTTCATGCTCTGATGGCCAAGAATGGCTGGCCGCATCTGAGCTG[G/A]CTGCTCAGTCAGTCTTCAAGGTATAACTAAAGGTCAGCTCAATCATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19689
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081026 Essential Splice Site 383 599 8 8
Genomic Location (Zv9):
Chromosome 2 (position 10861206)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11286302
GRCz11 2 11069901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAAATGCATAGATCCTGTTAAAATATAATACTTTTTTGTTGTCATTTC[A/C]GATAGTCCTGGAGGAATGCTGGTGATTCCAGTAAAATCCAGTGATGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31261
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081026 Nonsense 394 599 8 8
Genomic Location (Zv9):
Chromosome 2 (position 10861172)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11286268
GRCz11 2 11069867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTGTTGTCATTTCAGATAGTCCTGGAGGAATGCTGGTGATTCCAGTA[A/T]AATCCAGTGATGGTCACCCAAACATTCCTATTATTGACGGGTCTGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15963
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081026 Nonsense 431 599 8 8
Genomic Location (Zv9):
Chromosome 2 (position 10861061)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11286157
GRCz11 2 11069756
KASP Assay ID:
2259-1651.1 (used for ordering genotyping assays)
KASP Sequence:
ATTGCCTGGATTTGATTCTTGCYTCTACAAAGCYGTGGGGAATMTACTTA[C/T]AGATAAAATCCCAGAATCAGCTGAGCCTCTCACTGGAGCTCCTCCGTCAG
Associated Phenotype:
Not determined