Busch Lab

ZMP

ndnl2

Ensembl ID:
ENSDARG00000058212
ZFIN ID:
ZDB-GENE-031107-3
Description:
necdin-like 2 [Source:RefSeq peptide;Acc:NP_942107]
Human Orthologues:
MAGEB16, MAGED1, MAGED2, MAGED4, MAGED4B, MAGEE1, MAGEE2, MAGEF1, MAGEL2, NDN, NDNL2, TRO
Human Descriptions:
MAGE-like 2 [Source:HGNC Symbol;Acc:6814]
melanoma antigen family B, 16 [Source:HGNC Symbol;Acc:21188]
melanoma antigen family D, 1 [Source:HGNC Symbol;Acc:6813]
melanoma antigen family D, 2 [Source:HGNC Symbol;Acc:16353]
melanoma antigen family D, 4 [Source:HGNC Symbol;Acc:23793]
melanoma antigen family D, 4B [Source:HGNC Symbol;Acc:22880]
melanoma antigen family E, 1 [Source:HGNC Symbol;Acc:24934]
melanoma antigen family E, 2 [Source:HGNC Symbol;Acc:24935]
melanoma antigen family F, 1 [Source:HGNC Symbol;Acc:29639]
necdin homolog (mouse) [Source:HGNC Symbol;Acc:7675]
necdin-like 2 [Source:HGNC Symbol;Acc:7677]
trophinin [Source:HGNC Symbol;Acc:12326]
Mouse Orthologues:
Mageb16, Maged1, Maged2, Magee1, Magee2, Magel2, Ndn, Ndnl2, Tro
Mouse Descriptions:
melanoma antigen family B, 16 Gene [Source:MGI Symbol;Acc:MGI:1919217]
melanoma antigen, family D, 1 Gene [Source:MGI Symbol;Acc:MGI:1930187]
melanoma antigen, family D, 2 Gene [Source:MGI Symbol;Acc:MGI:1933391]
melanoma antigen, family E, 1 Gene [Source:MGI Symbol;Acc:MGI:2148149]
melanoma antigen, family E, 2 Gene [Source:MGI Symbol;Acc:MGI:2148316]
melanoma antigen, family L, 2 Gene [Source:MGI Symbol;Acc:MGI:1351648]
necdin Gene [Source:MGI Symbol;Acc:MGI:97290]
necdin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1913897]
trophinin Gene [Source:MGI Symbol;Acc:MGI:1928994]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16522 Nonsense Available for shipment Available now
sa37641 Nonsense Mutation detected in F1 DNA Not yet available
sa37640 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16522
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081038 Nonsense 18 260 3 11
ENSDART00000109878 None None 70 None 6
ENSDART00000123043 Nonsense 18 220 2 9
ENSDART00000138807 None None 120 None 5
Genomic Location (Zv9):
Chromosome 23 (position 13024250)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13156183
GRCz11 23 12912260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGTTTATAATAATGTTGTAATTCTCTCTCTTAATTCCCTKTAACTGCAG[C/T]GATCACAGTTATTGCTGGAGGAAGAKGAGGATGCAAACTTCAGCCAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37641
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081038 Nonsense 89 260 5 11
ENSDART00000109878 None None 70 None 6
ENSDART00000123043 Nonsense 89 220 4 9
ENSDART00000138807 None None 120 None 5
Genomic Location (Zv9):
Chromosome 23 (position 13021187)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13153120
GRCz11 23 12909197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCCTGCAGACATTGGAAAACATGTGATAAAGGACTACAAACACATCTA[T/A]GCGGAAGTCATGAACAGAGTTTGCCGTACATTTGAGCAGGTACAATGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37640
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081038 Essential Splice Site 175 260 8 11
ENSDART00000109878 Essential Splice Site 35 70 2 6
ENSDART00000123043 Essential Splice Site 175 220 7 9
ENSDART00000138807 Essential Splice Site 35 120 2 5
Genomic Location (Zv9):
Chromosome 23 (position 13017011)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13148944
GRCz11 23 12905021
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTAGATCTGGTGTGGAATACACTCAAGAAGCTGCGGTTGGATCCAGG[G/T]TTTGTTGCCTAGAACCTTTTAGGAAAAATTTCTTATATTGTTAAGTCTTT
Associated Phenotype:
Not determined