Busch Lab

ZMP

cxcr7b

Ensembl ID:
ENSDARG00000058179
ZFIN ID:
ZDB-GENE-031116-61
Description:
chemokine (C-X-C motif) receptor 7b [Source:RefSeq peptide;Acc:NP_001077301]
Human Orthologue:
CXCR7
Human Description:
chemokine (C-X-C motif) receptor 7 [Source:HGNC Symbol;Acc:23692]
Mouse Orthologue:
Cxcr7
Mouse Description:
chemokine (C-X-C motif) receptor 7 Gene [Source:MGI Symbol;Acc:MGI:109562]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16 Nonsense Available for shipment Available now
sa11907 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063665 Nonsense 76 362 2 2
Genomic Location (Zv9):
Chromosome 6 (position 15653378)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15626610
GRCz11 6 15753550
KASP Assay ID:
554-0062.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAACGCTCTGGTGGTTTGGGTGAACGTGAGAGCCGAGAGGACACGTTA[T/G]GAGACTCACCTGTACATCCTCAACCTAGCCATCGCTGACCTTTGTGTGGT
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
72 hpf
72 hpf
Stage Entity Entity Quality Tag
Larval:Day 5
ZFS:0000037
lateral line
ZFA:0001469
neuromast
ZFA:0000243
present in fewer numbers in organism
PATO:0001997
abnormal
PATO:0000460
Adult
ZFS:0000044
whole organism
ZFA:0001094

viable
PATO:0000719
normal
PATO:0000461

Mutation Details

Allele Name:
sa11907
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063665 Nonsense 207 362 2 2
Genomic Location (Zv9):
Chromosome 6 (position 15652985)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15626217
GRCz11 6 15753157
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACGCCATYGTCTGCAAAGCAGTTTAYCCAGTGGAAAGCATGAAGGAGTG[G/A]ACGGTTGGCATCCAAATGAGCTTCTTCATGCTTGGCTTTGMCATTCCCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26714
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063665 Nonsense 322 362 2 2
Genomic Location (Zv9):
Chromosome 6 (position 15652642)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15625874
GRCz11 6 15752814
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCACTGCTGTGCGAACCCCATCATCTACAACTTCATCAACAAGAACTAC[C/T]GATACGACCTCATGAAGGCTTTCATCTTCAAGTACTCCACCAAAACTGGC
Associated Phenotype:
Not determined