Busch Lab

ZMP

si:dkey-6n6.2

Ensembl ID:
ENSDARG00000058032
ZFIN ID:
ZDB-GENE-060503-173
Description:
hypothetical protein LOC751683 [Source:RefSeq peptide;Acc:NP_001038862]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34347 Nonsense Mutation detected in F1 DNA Not yet available
sa21224 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34347
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080832 Nonsense 151 297 4 8

The following transcripts of ENSDARG00000058032 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 14680794)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14126138
GRCz11 8 14163843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAATGGCTACACTCGCGACTCAAGCGGCAATCTCAACATGTGGCTGGCA[C/T]GACGATCCCTGACCAAACAGACATATCCTGGGAGACTGGATAACATGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21224
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080832 Essential Splice Site 206 297 6 8

The following transcripts of ENSDARG00000058032 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 14684117)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14129461
GRCz11 8 14167166
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAATCTGGAATCTTCCTTTCATGCCTCTCTCTGTCTCTTTTCTGTGCA[G/A]CTACACCTACGAAGATGATGAAGGAATATTTCCGGAGTGTCAGTTCGTCT
Associated Phenotype:
Not determined