Busch Lab

ZMP

eps8l1

Ensembl ID:
ENSDARG00000057984
ZFIN ID:
ZDB-GENE-050306-14
Description:
eps8-like1 [Source:RefSeq peptide;Acc:NP_001013331]
Human Orthologue:
EPS8L1
Human Description:
EPS8-like 1 [Source:HGNC Symbol;Acc:21295]
Mouse Orthologue:
Eps8l1
Mouse Description:
EPS8-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914675]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33123 Nonsense Mutation detected in F1 DNA Not yet available
sa40028 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33123
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080749 Nonsense 218 522 9 16
ENSDART00000133824 Nonsense 218 246 9 9
ENSDART00000133907 Nonsense 205 242 8 8
Genomic Location (Zv9):
Chromosome 3 (position 16142535)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16372754
GRCz11 3 16522554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAACCGCGCTGTGTGTTTGTTAGCTCTCAGCTCAGCGAGACTGTGCCT[C/T]AGTACACACCTGTCTTTTTGGATGGTTGGCAGCCGATAGCTGTAGACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40028
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080749 Essential Splice Site 272 522 10 16
ENSDART00000133824 None None 246 None 9
ENSDART00000133907 None None 242 None 8
Genomic Location (Zv9):
Chromosome 3 (position 16142292)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16372511
GRCz11 3 16522311
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACAGGTAATTGATCAGGCACGTCTGACTGTACACCAGGAGAATGACGG[G/A]TTAGTATGGACAGCTGTGTGTGTGTGTGTATGTGTGTCTATGTTAAGCTG
Associated Phenotype:
Not determined