Busch Lab

ZMP

zgc:136890

Ensembl ID:
ENSDARG00000057949
ZFIN ID:
ZDB-GENE-060312-28
Description:
solute carrier family 43 member 3 [Source:RefSeq peptide;Acc:NP_001035011]
Human Orthologue:
SLC43A3
Human Description:
solute carrier family 43, member 3 [Source:HGNC Symbol;Acc:17466]
Mouse Orthologue:
Slc43a3
Mouse Description:
solute carrier family 43, member 3 Gene [Source:MGI Symbol;Acc:MGI:1931054]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22442 Essential Splice Site Available for shipment Available now
sa35657 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7742
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080712 Nonsense 34 495 1 12
Genomic Location (Zv9):
Chromosome 14 (position 14969614)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16831600
GRCz11 14 17137253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTCRGGGTTGGTGGAGTGCTTGGGCTTCGCAGGGGCTGTTTTCGGCTG[G/A]GCATCGYTGGTKTTTGTGCTCAAGAACGAAGGCTACTTCAGCAGTCTGTG
Long Flanking Sequence:
ACATTTATTTATTAAAATCATCAGTAGGATCTCATCTAATCAGAAATGCTCAATGGAAAGTCACAAGGTTGTTATCTTTAAAGAAAACTGCTCCAACAGAACATGTGCAAACAGTAGCTTCGTAAGGGAGTCCTCTGGAAGAGAATAACAGGAGGGATTTACAAAAATGGGAGGGATTTACACAAAATGGGAGGGAATAGACACTCGGAGGCCCATATAAAGAGACAGCAAGCCAGAGGGAGGGAGGAGTGTGTGTCTGTGCACTTTGTGAATGTGTTAAAGACTCTGCTATTGTGCATTTTTGAGGTTTGCTTAATAACAGTCTTACATTTCTGTTGAAGGAGGTCAGAGAAACTCTGAGGCTGTTTGAGAAGACGAAAGAGAAGAGAAGCAGGCGAGATGTTCGGCTGTCAGGGAGACGGGTTGAGGGTCCGATCCTGGTTTACTTTGATCTCGGGGTTGGTGGAGTGCTTGGGCTTCGCAGGGGCTGTTTTCGGCTG[G/A]GCATCGCTGGTGTTTGTGCTCAAGAACGAAGGCTACTTCAGCAGTCTGTGTGTGAACACCACCATCAATGGAACAGCTGTTGAAGGTCAGTTTGTAAATGTTTAGCACATCCACCTGTTTAAACGGTGGGAGTACATTTAAAGGTGTAGAGTTCACCCCAAAATGAAATTACCTCATCATATATTCTTCCTCCCGTGGTCCTTTTCTTCTGTTGAACACAAAAGAAGATATTTTAAAGAATGCTGGAACTCATTTATTTCCATAGTGGAGGGAAAAAATACTGTACAAATTCAACGGATCCCAACAACTAGCATTACCTTTTTTTTGTTCAACAGAAGTAAGCCACTCAACATAGGTTGGATTTGTCAATCACTTTAACCATTTTTGTTTTTTACAGATTGCAGCAGACAGGATGAGCAGTTTTCCCTAATCTTTACCATTGCATCCTTTATGAACAACTTTCTTACACTTCCAAACGGCTTCCTGTTTGACCGCTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22442
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080712 Essential Splice Site 147 495 4 12
Genomic Location (Zv9):
Chromosome 14 (position 14974273)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16836259
GRCz11 14 17141912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCTTCATTTCTGTGGGAGGAATTCTGTTCTTGATGACCAACATACAGG[T/C]ACTGAATCACCCTTTGGGATCCTAATAACAAACATATGAGCCGCTGCACT
Long Flanking Sequence:
TTTTGTTTTAGGGTTATTTGATGAATAGGACACTCAGAATTCAATTTAAATTATTATTTGAATTTGTGCTCTGATTTGAACAGCGTTGCAGATTTTTTTTGCATAGCTCAAATATTTTTGGGAGCCCACTTTATCTCGCAGCTCAGAAATCTACAATAACACAATCCTCATGTTTCACAGACAGATATACAGAGACAGAGGCCAAAGAAAACAGCCAGCAGAATCTGCCACTTACTCCATTTATTACACTTCTCTCATGTTCTCACTCTGTTTTGATTTACTTTACAGATCAGTTTACTCTACAGGAATGTTGTTAATAGCCTTTTCCACAACTGGTGAGCAGTTTTCTCTTTGTTTGACCTTTAGTATATTGACAGATTTGAGTTAGATGTTTGTAGTCATACCATTGTTTTCTCCCACAGCGAGCTCTATCTTGCTTTTCCCCGCGCTGTCCTTCATTTCTGTGGGAGGAATTCTGTTCTTGATGACCAACATACAGG[T/C]ACTGAATCACCCTTTGGGATCCTAATAACAAACATATGAGCCGCTGCACTTCTCTGGGAAGCTTTCAGGGGGTTTTCTCATGATATCTGGCTACTTTTGTGGTTTAATTTTTATATTCTGTTTGTTGCCTGAAACCTAAAAAAACACTTTAGTTTAGGTCACAGTACATGATATCACATTAACTAACACTACTAGCTTTATAAACTATTAGCTGTTTATTTGTATAAGGTGAAAGTTGGGTTTAGGTTTTGGGTAGGATTAGGGATGCAAAATAAGATCATACTTTATAACTACTAATGAACAGTTAATATATGTTTTAATAGGTCCTGGAACTCCATGGTCATAAAACAATCCCATAATGGATTTACATTCTTGGAAAGAGTAGGGGTGTTACCCCGGTGTCCTGACCGAATTCCCCCCATTGGCCCTTACCGATCATGACCTCAAAATCATCCCCATCCACTAAATTGGCTGTGTCACTGGCTCTCCACTCCTCCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35657
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080712 Nonsense 450 495 11 12
Genomic Location (Zv9):
Chromosome 14 (position 14990129)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16852115
GRCz11 14 17157768
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGGTTTCGCTGCTCCAGTATCCCTGCTTTGCTCTCATTAAAGGGACAT[T/A]GGGTGGAGACCCTCTTTATGTAAGATTTCGAATGCTTTCAATGTTTCTTT
Long Flanking Sequence:
TTGGAAAAAAAGTGTATGGATACAAGTAGAGCTTGCTTGTTGTTACACCATATTTAAAATATTTTCATTAAAAAAATATCTTAAATATTTACATTGTTTCATTATTATTGTTTTATTAAATGTGTTAAGTTATATATTTTTTAATATAGCACATAAAATCTTTTTCATCTGGGCGATTTGAAACATTCCTTAGTGTTTAGCCCTTTTTGAATCTAAAATTTAATTTACAATAGTCCTAAAAATGTCTTAAAAAGTCTTAAATTTAACTTGGTGAAACCTACAGAAGACCTGCTTTTATTACTTCCACATTCAGTACAGTAAGAAATGCTTCTTCTTCATTTGTATCATAAGTGAAGTAAAATGTTGGTTTCATTTCTGTTTTTATTTTAAATGCAGGTTCCCGTCCGTACACTTTGGAAAGCTCTATGGAACAGTAATGGCTCTTTCGGCTGTGGTTTCGCTGCTCCAGTATCCCTGCTTTGCTCTCATTAAAGGGACAT[T/A]GGGTGGAGACCCTCTTTATGTAAGATTTCGAATGCTTTCAATGTTTCTTTTCCACAAGTACACGCACATTAACAACATTTCCACACACAAAAAACTCTCTATTGTCTAAATGTCAATCGTGTAGTGATTTATGAAGCACCCACACACAAAAAGATTTCAATTACAGTACATATAAATTCATTTCACACCATATTAACTGTGTGCATACATGGGGAATGACCTTTGAAATGACTGGATTTTGTTTTGATGACTATGAACACAGAAAACTAAACTTTTCTAACCTTCCAGTGGAGATCATGTTTTGGCTTTAATAGTAGATGATTAATGTAGATACGTGCACAAAAAATACAGTATTTTTTGTTTGTTTACTGACTGGCTTATTCTGTTTCAATTAGTTAATGTTTCTTTAAATAATTCTCCAACATTACCCTTATCATGTCTGCCAGGCATTTCTCCTTTTTCTTTGTAAGGAAATGTGGGAGGCTGTTTCAAAATAAGAT
Associated Phenotype:
Not determined