Busch Lab

ZMP

dido1

Ensembl ID:
ENSDARG00000057940
ZFIN IDs:
ZDB-GENE-030131-6117, ZDB-GENE-030131-6117, ZDB-GENE-030131-6117
Description:
death inducer-obliterator 1 [Source:RefSeq peptide;Acc:NP_001073424]
Human Orthologue:
DIDO1
Human Description:
death inducer-obliterator 1 [Source:HGNC Symbol;Acc:2680]
Mouse Orthologue:
Dido1
Mouse Description:
death inducer-obliterator 1 Gene [Source:MGI Symbol;Acc:MGI:1344352]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa14468 Nonsense Available for shipment Available now
sa10169 Nonsense Available for shipment Available now
sa41807 Nonsense Mutation detected in F1 DNA Not yet available
sa41806 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35061 Nonsense Mutation detected in F1 DNA Not yet available
sa5842 Nonsense Mutation detected in F1 DNA Not yet available
sa35060 Nonsense Mutation detected in F1 DNA Not yet available
sa16666 Nonsense Available for shipment Available now
sa8477 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14468
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 Nonsense 80 530 3 6
ENSDART00000110882 Nonsense 161 2779 2 15
ENSDART00000122078 Nonsense 161 598 4 8
ENSDART00000125453 Nonsense 161 282 4 4
Genomic Location (Zv9):
Chromosome 11 (position 18971828)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18389142
GRCz11 11 18551484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCTTCCGAGGCCAGCTTTGAWGGAAATGCAGAAGCCAAAATAGAGGAA[C/T]AAAAAGTAGCTTCAYCAGAGAAAAAGAAAAGGGGCAGAGGAAGGGCAAAG
Long Flanking Sequence:
TAGAATTCACATCATAATTTTGTGATCCACATTTTATATCTGCTGCGTTCTGATAATTAAACATTTGTTGTCAACTGTAATTATGCTACGTCTCACACACAGAACCAACATCAGTATCAGAAGAAGTCAAAGATCAGGAGCAAGGTGATGTTAGTGAAGACAAAGTAGAAGACCCTGACAAATCCTTAAAGCCTGCATGTGGTTTTAAGAAGACTTGGGGCTTTCGTCGGACCACCATTGCTAAGAGAGAAATCCCTGGAGAAATGGCAGCAGAGACCCCAGAAAGCAAAGGTGCACCTGTCCGTCGCAGTGGCCGGCAGGCGAAGCGCACGGACAAACTGGAAGAGTTTCTGGTCACAGTGAAGAGAGGAAGAGGAGCGGGTAGGAGAAGTTGCCCTTCACGAATTGAGGGAGGGGATCCTCCATCCCAGACCCCAACCGATGCTGAAACTGCTTCCGAGGCCAGCTTTGATGGAAATGCAGAAGCCAAAATAGAGGAA[C/T]AAAAAGTAGCTTCACCAGAGAAAAAGAAAAGGGGCAGAGGAAGGGCAAAGAGGCCAGTGAAGCCCAAAACAGGTGGAGGCTCGGTGAGTGATGATGGCAGCTCTGAAAATGAAGAGGAGACTGGCGAAGAGGTAGCTAAAGACACTCAAGAACATGTTGAGACTGTGGCCTGTGCTGAAGATGCAAAGAATGTGGAAGCAAAAGAGGAGCAACCGATGGATGTTGTAACAAAAGAAGAAGAGGTTTTGGAGGAGGGTAGTAAGAATGATGAGAAGTCCTTAAACGAGTCTGTAAATAGACGTCTTACCAGAGCTTGTAAAGACTCTAAACGTGACACTAAACCCAAAGTAGGAGTGAAACTCCGCAAAGAGAAAAAAGAGGAGAAAGATGATGACGATGATGATGACGACGATGATGATGATAATGATGAGTCATCGTCAGCCAGTGAGTCCGACAGTGATGGGTATGACCCGAATGCACTTTACTGCATCTGCAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10169
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 Nonsense 242 530 3 6
ENSDART00000110882 Nonsense 323 2779 2 15
ENSDART00000122078 Nonsense 323 598 4 8
ENSDART00000125453 None None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18971340)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18388654
GRCz11 11 18550996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGCCAGTGAGTCCGACAGTGATGGGTATGACCCKAATGCACTTTACTG[C/A]ATCTGCAGGCAGAAACACAACAAAAGGTATGTTTCTTTGTGTGCCAGTAT
Long Flanking Sequence:
AAAATAGAGGAACAAAAAGTAGCTTCACCAGAGAAAAAGAAAAGGGGCAGAGGAAGGGCAAAGAGGCCAGTGAAGCCCAAAACAGGTGGAGGCTCGGTGAGTGATGATGGCAGCTCTGAAAATGAAGAGGAGACTGGCGAAGAGGTAGCTAAAGACACTCAAGAACATGTTGAGACTGTGGCCTGTGCTGAAGATGCAAAGAATGTGGAAGCAAAAGAGGAGCAACCGATGGATGTTGTAACAAAAGAAGAAGAGGTTTTGGAGGAGGGTAGTAAGAATGATGAGAAGTCCTTAAACGAGTCTGTAAATAGACGTCTTACCAGAGCTTGTAAAGACTCTAAACGTGACACTAAACCCAAAGTAGGAGTGAAACTCCGCAAAGAGAAAAAAGAGGAGAAAGATGATGACGATGATGATGACGACGATGATGATGATAATGATGAGTCATCGTCAGCCAGTGAGTCCGACAGTGATGGGTATGACCCGAATGCACTTTACTG[C/A]ATCTGCAGGCAGAAACACAACAAAAGGTATGTTTCTTTGTGTGCCAGTATTTGTGGCCAATAATATTACTTAAATTTGAAATTGTAAAATGTGTGACTTTAAAATCTAAATGTTTAATAATGACACACTTGTAGTTTGGTTAACTTGGCTTATTTGGTTGGATCAAAAAAAGAAAGTGAGCCATTCAGTCCTGGTTTGCTTAGCCTTCACACTTATTTTTAAAACTGGTGTCCTGACATTTTATACCTGTCAGATTATGCTACCAACACTGCATTTGAATGGTTATGAGGTTGGGTTAGGAATTACGTATGTCAGGGCTATATTACAGCTTCATATTACAATAATCCACATTAAAATTTACACTGGTAGCAACATTTGATGGGTGCAAATTGCATCATCAAGATTTGCTACCTACTTTTTGAATTAGAGGTAGCTCAATCTGACAAGGAAGGACAAAAATAAATCTAACACAGGATCAAGATAAATAATCCAAACAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41807
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 Nonsense 272 530 4 6
ENSDART00000110882 Nonsense 353 2779 3 15
ENSDART00000122078 Nonsense 353 598 5 8
ENSDART00000125453 None None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18969856)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18387170
GRCz11 11 18549512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGTGATCGTTGTGAGGAGTGGTTTCATGGTGACTGTGTTGGCATTCCT[G/T]AGGCTCGTGGCCGGCTGATGGAGAGAAACGGAGAGGATTATGTCTGTCCA
Long Flanking Sequence:
ACACAATAATAACATTGTAGTTAACTTGTTTGTCAGTATTTTTATACCGTAGATAGTTTAGGAACATGTGAGTGGTGCATTTTTATTTACATGCATTTCTAATCATTCTACAATTTTTTTTTTTTTTTTTTCATAGAAAAATCTTTATACTATTTTCTATTTTGATTATATTTCATAAAACATCAGCGATGAGGATTTGGTCACATGTATGCAAAGTAAAATCCAAATTCTTAGCTAATGGATCTTCATTAAAAGAAGTTCAGCATTAAGGGACCAAACAATGGAATTAAGCATCATTTCAAGTGCCATTAAGACAGACTCGTATTGTTTACTTGATACAGAGATTGTCAGATTCTTACTTGCTTCAGCAGAGTTTTCTTTATGTGGATTTAATGAATATTCTGTGTGTTTGGTCATTGTTTAAATCCTTGTGCCATAGGTTCATGATCTGCTGTGATCGTTGTGAGGAGTGGTTTCATGGTGACTGTGTTGGCATTCCT[G/T]AGGCTCGTGGCCGGCTGATGGAGAGAAACGGAGAGGATTATGTCTGTCCAAACTGCTACACACAAAAAGGACAGATTTCCAAGGCCAGTTCCTCCACTGCAGCTGCAGAGAATGGCAAACGGCCAATAGTTGGCCCTCGTAAAACAGAGAGTGGTCTTACTGCACCATCTAGCACTGCTGCAGCTGCCGCAGAAGAAAAAGCTGATGACCTGGGCATCAAGGGCAGGATCGAGAAGGCTACCAATCCTAGTGGGAAAAAGAAAATAAAGATTTTCCAGCCGGTATGTCTCTGTATGAACAAGTCTGAATGCTGCGCTGTTGTTTACATTAATTTTTTGGGGTGAAAGAATTTTTCCTGTTGGTTTTTTATTTCAGTTTTATTTTGAGCTTTTATGCATGAGGTTTGAGAGCTTTTTTTCCACAGGATATTGTCTGATGCGTTCAAGTTTAACTTGTGATTTGATATATGATGTTTACAATCAGCATTTGATTGACGTTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27759
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 Nonsense 282 530 4 6
ENSDART00000110882 Nonsense 363 2779 3 15
ENSDART00000122078 Nonsense 363 598 5 8
ENSDART00000125453 None None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18969826)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18387140
GRCz11 11 18549482
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGACTGTGTTGGCATTCCTGAGGCTCGTGGCCGGCTGATGGAGAGAAAC[G/T]GAGAGGATTATGTCTGTCCAAACTGCTACACACAAAAAGGACAGATTTCC
Long Flanking Sequence:
TGTCAGTATTTTTATACCGTAGATAGTTTAGGAACATGTGAGTGGTGCATTTTTATTTACATGCATTTCTAATCATTCTACAATTTTTTTTTTTTTTTTTTCATAGAAAAATCTTTATACTATTTTCTATTTTGATTATATTTCATAAAACATCAGCGATGAGGATTTGGTCACATGTATGCAAAGTAAAATCCAAATTCTTAGCTAATGGATCTTCATTAAAAGAAGTTCAGCATTAAGGGACCAAACAATGGAATTAAGCATCATTTCAAGTGCCATTAAGACAGACTCGTATTGTTTACTTGATACAGAGATTGTCAGATTCTTACTTGCTTCAGCAGAGTTTTCTTTATGTGGATTTAATGAATATTCTGTGTGTTTGGTCATTGTTTAAATCCTTGTGCCATAGGTTCATGATCTGCTGTGATCGTTGTGAGGAGTGGTTTCATGGTGACTGTGTTGGCATTCCTGAGGCTCGTGGCCGGCTGATGGAGAGAAAC[G/T]GAGAGGATTATGTCTGTCCAAACTGCTACACACAAAAAGGACAGATTTCCAAGGCCAGTTCCTCCACTGCAGCTGCAGAGAATGGCAAACGGCCAATAGTTGGCCCTCGTAAAACAGAGAGTGGTCTTACTGCACCATCTAGCACTGCTGCAGCTGCCGCAGAAGAAAAAGCTGATGACCTGGGCATCAAGGGCAGGATCGAGAAGGCTACCAATCCTAGTGGGAAAAAGAAAATAAAGATTTTCCAGCCGGTATGTCTCTGTATGAACAAGTCTGAATGCTGCGCTGTTGTTTACATTAATTTTTTGGGGTGAAAGAATTTTTCCTGTTGGTTTTTTATTTCAGTTTTATTTTGAGCTTTTATGCATGAGGTTTGAGAGCTTTTTTTCCACAGGATATTGTCTGATGCGTTCAAGTTTAACTTGTGATTTGATATATGATGTTTACAATCAGCATTTGATTGACGTTATAGCTTTTACAAGCTCATTTTTTAAAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41806
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 None None 530 None 6
ENSDART00000110882 Essential Splice Site 868 2779 8 15
ENSDART00000122078 None None 598 None 8
ENSDART00000125453 None None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18963112)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18380426
GRCz11 11 18542768
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTCTATCCAAGGAGCTGTCAGACTGGAGAAAATCTGAGAGCTCTGAGG[T/C]AAAATGAGTTTTGAGTTTGTTGGTGTAAATTTAAATGATTATGTTGTTTA
Long Flanking Sequence:
GTCCTCCTGAATAGTCTATTAGTATGTTTTGAAATGAAATTATTTGTAACTTTTCTGACACCTATAGTTTTGGTAGGGATTTTTAATATTCCATTTGTTGTTGTGCCACAGGGTGAGTGACAGTGATGATCTCACAATGTCTGAGAACGAAGTGGGAAGATTGGCTGTAGGCATTGAGAAGGAGATGTTTAACCTTTGCATGAACACAGATAACAAGTACAAAAACAAGTACAGATCCCTTATGTTCAACCTCAAGGATCCCAAAAACAAGGTTAGTCACTTTGTTGAATAGACAGTTATTCTCTATTGAAATGCCTTATTTGTAGCTTGATGAAATCTAGTTATACTGAGAGTTCTGTTCTTTTACTTGACTGTGTGATAGGGCCTTTTTTACCGTGTAGTTGGGGGAGAGATCAGTCCTTTTAGGCTGGTGAGACTGAGTCCAGAAGAGCTTCTATCCAAGGAGCTGTCAGACTGGAGAAAATCTGAGAGCTCTGAGG[T/C]AAAATGAGTTTTGAGTTTGTTGGTGTAAATTTAAATGATTATGTTGTTTACATAAATTGTGTATGTATACAGAAAAGTCTGGATAAAAGTGGGAGATCCCACTCGGGTCAAATCAAAAGTGGATCCAGACAAGAGGCTACTCCCCTAGATATAGATATGGAGGAAGCTCCTCCAATGTCTGATGGAGATGTATGTATGCCTGCCACTTCCCAATCTCCTCACTTGGCTTCTGCTGCTGTAAGTGCTAGCTTTCTTGCTTTCCTGATCTGTATGTTTCTACACACACCTCTCTGTACGTCTCCTTCATTTCAGTTTTGCAAAGCGACTTGCTTTTCTCATAACTACCATCTTACTCGTAATATTTTTTTCTTTACATGAATGTTGATTGTTGAGTGAAGTGATTTTAATTTTTACTGACTCTTTTATGTTTGTGTGTGTGTGTAGTATGATATTTCATTTTTTCTTTTATATTGTTTTTATTTTGAACAGGATTCCCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35061
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 None None 530 None 6
ENSDART00000110882 Nonsense 1455 2779 15 15
ENSDART00000122078 None None 598 None 8
ENSDART00000125453 None None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18959777)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18377091
GRCz11 11 18539433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAAAGAGGTAGTACCAGATGATCGACCGTATGATCCTGAAGAAGAATA[T/A]GATCCGGCCATTGGCTATGATACAGAAAACACACAGGATACAACAAAAGC
Long Flanking Sequence:
GGAGCTCCTTTAGAGAATGAAGAAAAACGATCTAAAACTTTAAGAGATGAAGAGACGGGCCTTCCAAAACCATCTACTATTAGTAAATCTGAAATAAAACAGGACAAAGTTCATCGCTCTAGTCTAGATGCTATAAGCACAACTCCGCCAGGCTCCCCTCCACCTCTTAGTGTCGCTGATTCTTCAAGTTCTGTCTCTTCTGTGTTGTCCATACTCTCCTCTGTGAAAGCAACTGGTGTCAGCACAAGCACAGGCAGTAATTCACCATCCTCTATTGCAGCATCTGCAGTTTCCTCCACACCACTTCAGACTATCCTGAAAACACTTTTTGGTAAAAAGAAGCAAGATTCTGATGCTTCATTATCACCTTCTGATCAAAGTGCTGCAGATGTCTCTGTGCCTTCTGTGTCCATGCTAGATCCAATTGTTCAGCAGTTTGCAATAACTAAGGGGAAAGAGGTAGTACCAGATGATCGACCGTATGATCCTGAAGAAGAATA[T/A]GATCCGGCCATTGGCTATGATACAGAAAACACACAGGATACAACAAAAGCATCTGCTATTCAGCAAGCAGAGGTCTCGTCTGTGGTAGATGATGTTGCTTATGACCCTGAGGATGACTCTCTGTTTGATGAGGTTGAGACTGATCCAGGTTCAAAAAAATTACCTGAGCATCAAAAAGTGCTTGAAGATAAACAAATTGTAGAACAGAAGTATGAGGAACCAGTTCATCAGCAAATACCAGAGACGTTAGTTTCCCAGCCTATTACATCTCTGTTGGCTAACAATCAATTGCTTCAACTTGGCAAAAAGGTTGAAGAGTTGGTGACAAAGGGTTCAGCTACTCCAGTAATTAACCAAAGAAGAGACCCAAGGCAAAGTAGAGACCCAAGGCAGACAACTGCAAGTAGAAGACAGATGTCTGATTCCACAGAAATGGAGGAGGAATCTCCTATTACTACAGACAAATCATCCACACAACAGGATACAGAGATATCAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5842
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 None None 530 None 6
ENSDART00000110882 Nonsense 2168 2779 15 15
ENSDART00000122078 None None 598 None 8
ENSDART00000125453 None None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18957640)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18374954
GRCz11 11 18537296
KASP Assay ID:
554-3697.1 (used for ordering genotyping assays)
KASP Sequence:
TTGGCCAGCCAATACGTTTTAGCTACAAAGATGATACTCCAGGTGACATC[C/T]GAGATGCAAGAGATGTCCGGGACGCAAGAGACATTCGAGACATCCGAGAT
Long Flanking Sequence:
CTCCACCATTTTCTGGTCCCCCACCAAATCATTTTGATAATAGAGCACCACCATCATCCCACTTCTCGGCTACAAGAGGTCCGCCTGCTCTTCATAACATTGTGGATCATGGCCCTCCATCTAGTATAACAAGAGGGTCTGCAGATCCGTTTGAAGATAGAGGAAACTCTTATCATCAGGGAATAGAGAAGCCCCAGATACCCCCACAAGTTCCTTCTTTTAGAGGCCCTCCACCAAACCCCTTTGATGGACGAAGAGGACCTACAGGTGAAATGTCAGGGCAGCGATTTCCACTTCCGAACCAATTTCATAGTTCACCTCAACACAGGGGATCTTTTGAGGAACCACGAGGAACTTCATCTCAAGACTTTGAAAGGCACCTAGGGCTGTCAGTGCAGCAGTTTGGTGGGCCAAGAGGTCCACTACCTGGACATTATGATAAGGAAGCTGTTGGCCAGCCAATACGTTTTAGCTACAAAGATGATACTCCAGGTGACATC[C/T]GAGATGCAAGAGATGTCCGGGACGCAAGAGACATTCGAGACATCCGAGATGCACGAGACATCCGGGACCCAAGAGACATTAGAGACATCCGGGACTCAAGAGACATTAGAGATATTCGGGACGCAAGAGACATTCGAGACATGCGGGACCCAAGAGATGTTCGAGACGTCCGGGACCCAAGAGATGTTCGGGATGTAAGAGATATCCGAGATGTTCGGGATGTAAGAGACATCAGAGATTCAAGAGAAGTTCGAGACGGCCGAGATGCAAGAGAAGTTCGAGACATCCGAGACGCAAGAGAAGTTCGAGACATCCGAGACGCAAGAGAAGTTCGAGACATCCGAGACGCAAGAGAAGTTCGAGACATCAGAGACCCAAGAGAAGTTCGAGACACAAGAGAGGTCCGAGATGCAAGAGAAGTCCGGGACGCCCGAGATGCAAGAGAAGTTCGAGAGGCAAGAGAAGCTCGAGACGTGCGAGATGCAAGAGATGTTCGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35060
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 None None 530 None 6
ENSDART00000110882 Nonsense 2324 2779 15 15
ENSDART00000122078 None None 598 None 8
ENSDART00000125453 None None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18957172)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18374486
GRCz11 11 18536828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTCCGGGACGCCCGAGATGCAAGAGAAGTTCGAGAGGCAAGAGAAGCT[C/T]GAGACGTGCGAGATGCAAGAGATGTTCGAGACATCCGAGAAGCAAGAGAA
Long Flanking Sequence:
TTAGCTACAAAGATGATACTCCAGGTGACATCCGAGATGCAAGAGATGTCCGGGACGCAAGAGACATTCGAGACATCCGAGATGCACGAGACATCCGGGACCCAAGAGACATTAGAGACATCCGGGACTCAAGAGACATTAGAGATATTCGGGACGCAAGAGACATTCGAGACATGCGGGACCCAAGAGATGTTCGAGACGTCCGGGACCCAAGAGATGTTCGGGATGTAAGAGATATCCGAGATGTTCGGGATGTAAGAGACATCAGAGATTCAAGAGAAGTTCGAGACGGCCGAGATGCAAGAGAAGTTCGAGACATCCGAGACGCAAGAGAAGTTCGAGACATCCGAGACGCAAGAGAAGTTCGAGACATCCGAGACGCAAGAGAAGTTCGAGACATCAGAGACCCAAGAGAAGTTCGAGACACAAGAGAGGTCCGAGATGCAAGAGAAGTCCGGGACGCCCGAGATGCAAGAGAAGTTCGAGAGGCAAGAGAAGCT[C/T]GAGACGTGCGAGATGCAAGAGATGTTCGAGACATCCGAGAAGCAAGAGAAGTTCGAGACGTCCGAGATGCAAGAGAGGTTCGAGACATCCGAGATGTAAGAGACGTCAGAGATCTAAAAGACATCAGAGAAATCCGAGACATTAGAGATATTAGACCTATTCGTGGACCTCTGCTACCAACACCTCCTGAAGGTCCTATACCAATACTGGCTCGTATAGGTGGACACAGCCCCGACACCCACCGTGATGACCCCTGGAGAAGGCACTCCCCTGAAATGCGAAGACGAAGCTGTTCCAGCAGAGATGGTTCAGAGTCACATACCCGCCCAAGTAGATTTGAGGGTGGTCCACGTGACAGAGATGCCCCCTCAAGATTGTCAGAGGAGAGGCAGCGTGAAATGTCTGAAGACAGGAGAAGAGACAGAGACAGAGAAGGTGGTCATGGTGGACGGTCTTGGGCCTGGAACAGAGAACATGAGTATGACCGAAGCAAAGAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16666
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 None None 530 None 6
ENSDART00000110882 Nonsense 2539 2779 15 15
ENSDART00000122078 None None 598 None 8
ENSDART00000125453 None None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18956527)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18373841
GRCz11 11 18536183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGCAGAGAGTCMGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCC[G/T]AWCGGGGCAAGGAGTCCGAACGGGGCAAGGAGTCCGAACGGGGCAAGGAG
Long Flanking Sequence:
GAGATATTAGACCTATTCGTGGACCTCTGCTACCAACACCTCCTGAAGGTCCTATACCAATACTGGCTCGTATAGGTGGACACAGCCCCGACACCCACCGTGATGACCCCTGGAGAAGGCACTCCCCTGAAATGCGAAGACGAAGCTGTTCCAGCAGAGATGGTTCAGAGTCACATACCCGCCCAAGTAGATTTGAGGGTGGTCCACGTGACAGAGATGCCCCCTCAAGATTGTCAGAGGAGAGGCAGCGTGAAATGTCTGAAGACAGGAGAAGAGACAGAGACAGAGAAGGTGGTCATGGTGGACGGTCTTGGGCCTGGAACAGAGAACATGAGTATGACCGAAGCAAAGAAAGGGATCGGGAAAGAGACCGGAGCAGAGAAAGAGATAGGGAGCAAGGTCACAGCAGGGAAAAGGAGAGAGAACACAGCAAAGAGAGGGATCGCAGTAGAGGCAGAGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCC[G/T]AACGGGGCAAGGAGTCCGAACGGGGCAAGGAGTCCGAACGGGGCAAGGAGTCCGAACGGGGCAAGGAGTTCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCGGAACGGGGCAAGGAGTCGGAACGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGACCGAGGCAAGGAGTCCGACCGAGGCAAGGAGTCCGACCGAGGCAAGGAGTCCGACCGAGGCAAGGAGTCCGACAAATATGGAGATGGAGACAAAAGAAGAGACCGGGATCGAGACAGAGAGCGAGAGCGTGGCAGAGAGAGAGAGGACAGAAAGGACCATGATCGAGATAGAGCGAAAAACAGAGAGAGAGAAAAAGACCGTGACAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8477
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103950 None None 530 None 6
ENSDART00000110882 Nonsense 2664 2779 15 15
ENSDART00000122078 None None 598 None 8
ENSDART00000125453 None None 282 None 4
Genomic Location (Zv9):
Chromosome 11 (position 18956152)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18373466
GRCz11 11 18535808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCGAGGCAAGGAGTCCGACCGAGGCAAGGAGTCCGACAAATATGGAGAT[G/T]GAGACAAAAGAAGAGACCGGGATCGAGACAGAGAGCGNNNNNNTGGCAGA
Long Flanking Sequence:
GCAGAGAAAGAGATAGGGAGCAAGGTCACAGCAGGGAAAAGGAGAGAGAACACAGCAAAGAGAGGGATCGCAGTAGAGGCAGAGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGAACGGGGCAAGGAGTCCGAACGGGGCAAGGAGTCCGAACGGGGCAAGGAGTCCGAACGGGGCAAGGAGTTCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCGGAACGGGGCAAGGAGTCGGAACGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGATCGGGGCAAGGAGTCCGACCGAGGCAAGGAGTCCGACCGAGGCAAGGAGTCCGACCGAGGCAAGGAGTCCGACCGAGGCAAGGAGTCCGACAAATATGGAGAT[G/T]GAGACAAAAGAAGAGACCGGGATCGAGACAGAGAGCGAGAGCGTGGCAGAGAGAGAGAGGACAGAAAGGACCATGATCGAGATAGAGCGAAAAACAGAGAGAGAGAAAAAGACCGTGACAGAGACCGAGATAGCAGGGACAGAAGGAGAGAACGCTCAAGGAGTCGTGAACGAGATCGTGGTAAAGATCGTGACAGAAGAGATCGTGACAGAGAACGGGACAAAGATAGAGGCAAGGAGAAAGAAAGAGACAGACGGGATAGAAGCAGGAGCAAAGAAAGGAAAGATAACAGAAAAGAAAGATCTGAGAGCTCAAGAGCAAAGTCCACAGATTCTGAAAATCCATCATAAAGGTCATTCATATTCAATCTTGAGTGATACTTTTTTTCCTTTCTAAATTTGCATGGATTTGAACATTGTGCTTGAAAGTCTCTTTTGTATATTTTCTTGCTGAATATTTTATGCTTTTTACACACAAGCGTTGTACTTTGTATGTGATGA
Associated Phenotype:
Not determined