Busch Lab

ZMP

ythdf3

Ensembl ID:
ENSDARG00000057939
ZFIN ID:
ZDB-GENE-030131-6123
Description:
YTH domain family protein 3 [Source:RefSeq peptide;Acc:NP_956164]
Mouse Orthologue:
Ythdf3
Mouse Description:
YTH domain family 3 Gene [Source:MGI Symbol;Acc:MGI:1918850]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44147 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44147
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080837 Essential Splice Site 17 600 2 5
ENSDART00000122294 Essential Splice Site 17 600 2 5
Genomic Location (Zv9):
Chromosome 24 (position 24894400)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24141278
GRCz11 24 24286452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACACTCTTTGAACCCAAAATAAGAGACCTAAAGGACAAGGAAACAAAGG[T/A]ATGTGTTGTAAAGAGTTTAAAATGAACCTATCATTATTTGCTTACCCTTA
Long Flanking Sequence:
GGCGAGCAGATCAACGCCTGAGAAATACGCTGTGATTATAGGGCAACCCGGAGGGAGGAAAAAAAATAACGTGAACCCGCAGCGGTGGCAGGAGAGACCGTGGACAGTCATATCAGCAATCAGTTTGGGCTCCCGGAGGATGTCTGCGACAACTGTCGATCAGGTACGAGAGACTGTATCCATATAAACATGATAGTGCACGCACAGGTAATGGCTGTGTCTCAAAACCCAGTGAGTCGCCTACCTAGACAGCATATCTGGGCGCGCTTGGGCGAGTCAACTTTTCAAATAGGCTTTAAAAAGCGTCAACGTCAATCTTGGTCGCTTATCTGTAAATCAAGAGTGTTTGGTGTTTACTAGATGTTCTTGCTAGGCCGAATTGTTGTGTACATGTTTGTTTCTTCATAAATTGATGTTTACGTTTTTTTCCTCTCTCTCTTTGTCACTGTCCACACTCTTTGAACCCAAAATAAGAGACCTAAAGGACAAGGAAACAAAGG[T/A]ATGTGTTGTAAAGAGTTTAAAATGAACCTATCATTATTTGCTTACCCTTAATAGTTATGAAATACAAGATGGTAGATGTTGTCATTCTCGTTTTTTCCTCTCCATATAGTAAATGATAACTAAAACTGTCATTAGGTGAAATGAACAACATGCGGATCATGACAAACATATTTTTGCATGAACTGTTTTTTTAAGGATGTTTGGTTTGCTAGATGTGTCTCATTTATAAATATTCCTTCCTTCTGTGAGTGCAGACCAGTCTTAGTTTTAATCTGCCTGTCTATGTGACTTAATAATTTTGACATTGATAGGCAAAGCTATTTACTGTGATTAATATTCACAGAAACTCTTTTACATCTTTTGTTTGTGCGTGGACATGTTCATTACTGAATGTAATTTACTTGTGCTGGGTCTCAATATTTCATATCAACATCACAGTGGTTTGATGAAGGTTAGTAAAATTAATTGACTCCGTCTGTCGTATAATTTTGTTTAGTGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4272
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080837 Nonsense 592 600 4 5
ENSDART00000122294 Nonsense 592 600 4 5
Genomic Location (Zv9):
Chromosome 24 (position 24897111)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24143989
GRCz11 24 24289163
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGACGATTTTGCACATTACGAAAAGCGGCAGGAGGAAGAGGAAGCCATG[C/T]GAAGGGTAAGCGCAGCTTTCTGCCACTCTTCACAATAGCAGAAAGCAGGC
Long Flanking Sequence:
ACTGGACCTTGAAAAACGGACGGGTCTTCATCATCAAGAGCTACTCTGAGGACGACATCCACCGCTCCATCAAGTACTCCATCTGGTGCAGCACAGAGCATGGAAACAAGCGCCTGGATGGTGCCTACCGCTCGCTCAGTGCCAAAGGTCCACTGTACCTGCTCTTTAGTGTCAATGGCAGTGGACACTTCTGCGGCGTGGCGGAGATGAAGTCAACCGTGGACTATAACGCGTATGCTGGCGTCTGGTCCCAGGATAAATGGAAGGGCAAGTTTGAGGTGAAATGGATCTTTGTTAAGGACGTGCCCAATAACCAGCTCCGGCACATCCGCTTAGAAAACAATGACAACAAGCCTGTCACCAACTCCAGAGACACTCAGGAAGTGCCCCTAGAGAAAGCAAAGCAAGTGCTTAAAATTATTGCGACTTTCAAGCATACCACCTCAATCTTTGACGATTTTGCACATTACGAAAAGCGGCAGGAGGAAGAGGAAGCCATG[C/T]GAAGGGTAAGCGCAGCTTTCTGCCACTCTTCACAATAGCAGAAAGCAGGCACTGCACCTTTAGATCTCATAAACATTGTTATGTTTTAGTGCTGTCAGCATGTCTGTTTCTTTCCTAAGGTAGTTTTTTGAATAGCAGCTCATTTCTGATCCAGATTAGCCTTTCTGTCTCTCATATGTTTTAGAAACAAGCAGCAGCAAGACAAAACCAGTGCAGTCAGTCATAATTTAAAATGAAATGTTTGATATGGTAGCTCAATACATCATTACAGGAGGTGAAGAAATGCAACGTTTGTGTATTATTTCTCAACACGGCTTGCACATATTTCACACATTTCCTCATATTTCAATTAGCTGAAGTGTCAGCAGATAAGTATTGTGTAATAATTTGAAGTAACTGACTAAGAAGTCTCTACCAATCAACAAAAGCCTGGTGTTGAGCAGTGGCACCAATCAGTCAGATTTCCCATTAATAGATTAGACTTGCATCATTTCCTGCCC
Associated Phenotype:
Not determined