Busch Lab

ZMP

cep72

Ensembl ID:
ENSDARG00000057934
ZFIN ID:
ZDB-GENE-101115-1
Description:
Centrosomal protein of 72 kDa [Source:UniProtKB/Swiss-Prot;Acc:Q501X2]
Human Orthologues:
CEP72, LRRC36
Human Descriptions:
centrosomal protein 72kDa [Source:HGNC Symbol;Acc:25547]
leucine rich repeat containing 36 [Source:HGNC Symbol;Acc:25615]
Mouse Orthologues:
Cep72, Lrrc36
Mouse Descriptions:
centrosomal protein 72 Gene [Source:MGI Symbol;Acc:MGI:1921720]
leucine rich repeat containing 36 Gene [Source:MGI Symbol;Acc:MGI:2448585]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30337
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080696 Essential Splice Site 25 532 1 14
Genomic Location (Zv9):
Chromosome Zv9_scaffold3474 (position 24406)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52961333
GRCz11 16 52847166
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGAACAGTGGATCAGAGAGAAACTCAACCTTCAGCATCGATGTTTAGG[T/A]AAACTTTTATACAGTTATTTATATAATATAGTTTTTATTTGATTAACTAA
Long Flanking Sequence:
GTCTGAGGACGGTGACGCTGATTTGCCGCCAGAGGGTGATAACGTCACTACGCAAACATTTCTCTCTCACGTTAACACTTTAACAGAGCACTCCTGACCTGTTTAATGTATATTTCCATAACTTCACATAGTCGGTGTAGTTTGATAACATCCTCTTCACGCTGGTTGACATATTACTCATCCAAATATGAACACTTTTTGTGAGCTGTTGCTCGGTAACCCTCCTCAGCCAAACATCCATACTCTACTCATAAATAATATTCAAAAGGTAACCATTTATCGATGTTTGATTGGCTAATTCAACACAACCCTCCCCAACGTCTAGTTTTCAGCAAATCAGATGAGCCTGCGTCTCATTACGTGATTAATATTCATAAGCCGCTCTTTGTCCTGCACATGCGCAGTGTGAGGTTATTCTTCAAAACAATGGCGGTAGACGGTTTGCCCATAACAGAACAGTGGATCAGAGAGAAACTCAACCTTCAGCATCGATGTTTAGG[T/A]AAACTTTTATACAGTTATTTATATAATATAGTTTTTATTTGATTAACTAATATTTGTAGTCATTTATTACAGCGGATGTCCGATCATTGACTCTACCAGGAACATACGAAGGGAAAATCTGTCATTTAGGAACATCACTGAAGAACTTTGTCCGTCTGAAATCGCTGGATCTCTCATATAACGCACTGGTCACAGTTCAGGTGAATATTATTTATTCATTCATTCATTTTTTGTCAGCTTAGTCCCTTTGTTAATCCGGGGTCACCACAGCGGAATGAGCCGCCAACTTATCCAGTAAGTTTTTACGCAGTGGATGCCCTTCCAGCCGCAACCCATCTCTGGGAAACATCCACACACACATTCACACACACACACACACTCATACACTATGGACAATTTAGCCTACCCAATTTACGTGTACCGCATTTCTTTGGAATGTGGGGGAAAACCGGAGCACCCGGAGGAAACCCACGCGAGAACATGCAAACTCCACACAGAAA
Associated Phenotype:
Not determined