Busch Lab

ZMP

rps6ka3b

Ensembl ID:
ENSDARG00000057927
ZFIN ID:
ZDB-GENE-070209-74
Description:
ribosomal protein S6 kinase alpha-3 [Source:RefSeq peptide;Acc:NP_001076495]
Human Orthologues:
RPS6KA3, RPS6KA6
Human Descriptions:
ribosomal protein S6 kinase, 90kDa, polypeptide 3 [Source:HGNC Symbol;Acc:10432]
ribosomal protein S6 kinase, 90kDa, polypeptide 6 [Source:HGNC Symbol;Acc:10435]
Mouse Orthologues:
Rps6ka3, Rps6ka6
Mouse Descriptions:
ribosomal protein S6 kinase polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:104557]
ribosomal protein S6 kinase polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1914321]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24507 Nonsense Available for shipment Available now
sa960 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa24507
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066648 Nonsense 108 688 6 22
ENSDART00000130057 Nonsense 139 739 6 22
ENSDART00000135060 Nonsense 139 709 6 21
Genomic Location (Zv9):
Chromosome 24 (position 24818698)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24065576
GRCz11 24 24210750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTTTACCAGTGAACGCATTCGCTTTTCTCTCACAGCATTCCAGACC[G/T]AAGGAAAGCTTTATCTGATTCTGGACTTCTTAAGAGGAGGCGATCTCTTT
Long Flanking Sequence:
TGAAAAAAAAGAAAAACCTGTAGTGTCTCGCCTTAAAACTCTAAATCCATGTCCCTCCTGATGATCAACATCTTCATCCACATGAGTAAATGGATTCTCCTCTCCCTTCAGCTCTCAGCTTCTCTTGTCTCTCTCCTGCGCTGCATTTTCCCCCTCTTTTATTTAATTAGTCATCCATTGCCATCTGCGTAATTGTGTTGTGCCAGATTCCTGGACGTAGGGAGGATTGGGGGCTGTTAAAGTGGAGAGAAAACATTGTTAGTGAACTTAATAGAAGTAAACTCAAGTGTTGTTATTTATGCATGTGTTTTCAGTACGGGATCAGGTCCGGACTAAGATGGAGCGGGACATCCTGGTGGAGGTTAATCATCCCTTTATTGTTAAGCTACACTATGGTGAGCGCTGGTCATCATTAGCCAATCTGAATGAAGAGCAGCTGCTGATTTAATGTTGTGTTTACCAGTGAACGCATTCGCTTTTCTCTCACAGCATTCCAGACC[G/T]AAGGAAAGCTTTATCTGATTCTGGACTTCTTAAGAGGAGGCGATCTCTTTACTCGACTGTCAAAAGAGGTATTTAATGAATGGTTTAGGGTAATAATGATACACAAAATTGACAAATCACTTTTTAAATTTTTGACCAGTGTTGAAGTGTTAAAGTTGTGTTCTGGCTGATTAAGATGTGAAGCATATTCTATACTTTTTTCTGTTCTTTTTTTTCCTCTGCTCAGGTGATGTTCACTGAAGAGGATGTGAAGTTTTATTTGGCCGAACTGGCTTTGGCTCTGGATCATCTGCATGGACTGGGCATCATTTACAGAGATCTGAAACCAGAGAAGTACTGAATGTTCTCTAAATAAGCCTATATACAGTGGAGCAAAAAAGGTATTTAGTCAGCCACCAGTTGTCCAAGTTTTCCTACTTAAAAAAGATGAGAGAGGCCTGTAATTTACATCATATGTCTCAATTATGAGAGACAAAATGAGAATATAATCCAGAAAATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4278
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066648 Essential Splice Site 302 688 13 22
ENSDART00000130057 Essential Splice Site 333 739 13 22
ENSDART00000135060 Essential Splice Site 333 709 13 21
Genomic Location (Zv9):
Chromosome 24 (position 24805261)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24052139
GRCz11 24 24197313
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGGCCGAATGGTGGTTGTAATGTTCATTTTCATGCTTTGTATGTCTCA[G/T]AAATTATTTAGAAGAGAAAGTCACCCACCCTTCAAACCAGCCACTGGCAG
Long Flanking Sequence:
GCTTCTCTGCAGGTGCTGGTCCAGATGGAGTTGAAGAGATAAAGAGACACCCATTTTATGTTTCTATTGACTGGAATGTGAGTTTTTTACTGGAACATTCACTTACTTTGAATAGGGATAAAGCTTTACAATAAAGTCCTGTTAGTTAATAAAAATTACATACAAACAATGTTACAAATAACACCAGTTTTTATGGATATGGGTACTACATTTACATTTTTATAGTAGCATTATTTATATTAATTTTTGATTTTATAATTTTACAATTACAAAAGATGCTTTTGAATTACTGAATTTACATTAATAATGTTATATTATTTAAGAAATATACATATTTAAATGTTTTAATTACACTAGTTCACAGGTGAAACATTTAGCTAGTATTATTTTCTTAATAGTTCATGTTAACTAACATAGTTAACAAATAAAACCTCAAGTTTTACCTGAATAAGTGGCCGAATGGTGGTTGTAATGTTCATTTTCATGCTTTGTATGTCTCA[G/T]AAATTATTTAGAAGAGAAAGTCACCCACCCTTCAAACCAGCCACTGGCAGACCAGACGACACATTCTACTTCGACCCAGAATTTACCGCAAAAACTCCCAAAGGTACACCAGCTTCTAATCGACTAGATCAGGTAGACTGTGTGTTTGTCATCCATCTTTTATCCCCTTTGAGACAAACACCAAAACCTATTTAATGCAACTCTGCTCTGCCTCTCGAAATCTGTTGGATGATTTGATGCTGTATTAAACACTGGATCTGCCACCGGATGAAATCTATTCATAGCTTTTTTTTTTTTACTTTTTTTTACTTTTTTTACACATCCTCATGTTTCTGGCAAAGAACAATATATGGTACTGTAACTTCATTTACATTATTTACAATATAATTGTTTTTCATAAAAGTTCAAAAGCCTTGTAATAACCTATCAAGCCATGTGTTTACATGCACATTCTTAAGCCAATTATGCCTAATAGGCTAATACGTGTAATGTCATGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa960
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066648 Nonsense 348 688 14 22
ENSDART00000130057 Nonsense 379 739 14 22
ENSDART00000135060 Nonsense 379 709 14 21
Genomic Location (Zv9):
Chromosome 24 (position 24802526)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24049404
GRCz11 24 24194578
KASP Assay ID:
554-0865.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTTTTTNTTTTNNNNNNAGATTCTCCAGGTGTACCTCCTAGTGCCAATGCCAAT[C/T]GACTTTTTAGAGGGTTTAGTTTTGTGGCCATCACTTCAGAAGAAGAATCT
Long Flanking Sequence:
GAAATAAGTAGATTTATGGACACTAGACACAATAGGTATTAGAGGTACTACTGTACATGCCATGACTGATAATGAGTCTGGTATCCTAGGTGAGTGTTGTATCCTGTGTAGGCTCAGACTAAAAAAATAATTTTAGTACTCTACACTGTTAAAAAATACAGGTTGCCTTACATGTTTAAGCTGAATCAAATTAATCTTATGAGTCATTTTAACTTATATTACATTAAACTTAAGCTTGCTTAACTTATAAAATTAAGTTAGAACCCAACCAACTTAGTTTAATAAGTTACAATTAACTAAAAAGAAATGTTGTCATGACTAATTGATCATATCATCTTTTACAGTGTAGAGTGTAGTCATTATCTTGTGATGTCCACGGAAAAAATGTTACCTTCTGGTGGTTCTAGTGTTAAAGACTAGATCAAAACATTGGTGTGTATTGGTTTATGTTTTTTTTTATTTTAGATTCTCCAGGTGTACCTCCTAGTGCCAATGCCAAT[C/T]GACTTTTTAGAGGGTTTAGTTTTGTGGCCATCACTTCAGAAGAAGAATCTCAATCCCTGCCGAGCAACAGCATGTCATCTATAGTTCAGGTATGTGCACTTGCATAACACGTTTCCTCCAAATTAAACCTGTTTCTTCATTTTAATGACTGCATTTACATCTTGGTTGTATTGTGTATTTATAGCAGCTCCACCGAAACGTGTCTCAGTTTAGTGACGCATATGAGGTGAAGGAGGATATCGGCATTGGTGCTTATTCCATCTGCAAACGCTGCATTCAGAAAAGCACAATGATGGAGTATGCAGTGAAGGTGAGGAAAGAATTATATTAGAACACCACAATACCAGATATAACCGTATATTAGCAGCAAATCAACCCTTTAAAAAAAAGCACTTGAACTTCTTTAGCTAATAGATTTTAAAACTTTATATTATTAACTAATGTAGGTAAATATTGGATATGTTATACATTTATAAATATTAGTGCCGTGCAAAGATTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30102
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066648 Nonsense 612 688 20 22
ENSDART00000130057 Nonsense 673 739 21 22
ENSDART00000135060 Nonsense 643 709 20 21
Genomic Location (Zv9):
Chromosome 24 (position 24795026)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24041904
GRCz11 24 24187078
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGATGTTGCATGTAGACCCTCATCAGAGACTCACTGCTGCACAGGTTT[T/G]AAAGCATCCCTGGATCACTCACAAAGACAAGCTCCCCAATTACCAGCTTA
Long Flanking Sequence:
TGTCTGTATTCAACTAACACCACGCTTTTCCCTACAGATTTACTCCATTTGCTAATGGCCCCGAGGATACGCCGGAGGAGATTCTGGCTAGAATCGGCAGCGGACAGTTTTCCCTCACAGGAGGATTTTGGAACTCTGTTTCTTGTCAGGCAAAGGTGTGAATCTGAGCATCTCAATTAAAGACATAGTTCATCCAAAAATTACAACAAACCACTTACCATTTACCACTTACCATAAACCAGTAACCATTGACAGTAATAGGAAATAAAAAATACTATGGAAGTCATTTGCTATGAAAGTCAGTTTTGGAATAAGGGGAGGCTTGGTAAATTTTGAGAGAATTGTAGATTATTGAGTGAACTGTCCCTCAATTCTCATTAAAGCTCCACCAAATGAAAATAGTTCTTAGAAGAATCATGGTTATTGTTGTTTCCCACAGGATCTGGTATCAAAGATGTTGCATGTAGACCCTCATCAGAGACTCACTGCTGCACAGGTTT[T/G]AAAGCATCCCTGGATCACTCACAAAGACAAGCTCCCCAATTACCAGCTTAATAGACAGGACGCCCCACATCTGGTTAAGGTTTGTCCTTCTTTAGACATGACACTATATAATAACATCTAAATGTCTTGAAATATTCACAGAATTATTGTTATATGGCCTTGAAATGCTGTTTGACTTGACTGGTTTAGAATTATTTAACATTCATTTTAAGAGCATTTATCGCTGAATATAAAGTTGTTTAAACTGAAAAATGAAACAAGACTAACATGTTTTGGTTAGGTATACAATATAAAAATGCAAGTCAATATATTATGCTTAACTCTAAAAAAAAATTATAATAAAAAAATCTGTCAGCCCAGTTAAATTATTTTTAATATTTGTTATATCAAAGCTTAATAATACATATATGTTTTTTTTTAAAAACATATATTTGACACATATATGTCAAATACATTTTGACACATTTGAGTTTATTCTCTCCTACATTTTTTTTTATATG
Associated Phenotype:
Not determined