Busch Lab

ZMP

zgc:86709

Ensembl ID:
ENSDARG00000057911
ZFIN ID:
ZDB-GENE-040625-35
Description:
cardiac muscle alpha actin 1 [Source:RefSeq peptide;Acc:NP_001002066]
Human Orthologues:
ACTA1, ACTC1
Human Descriptions:
actin, alpha 1, skeletal muscle [Source:HGNC Symbol;Acc:129]
actin, alpha, cardiac muscle 1 [Source:HGNC Symbol;Acc:143]
Mouse Orthologues:
Acta1, Actc1
Mouse Descriptions:
actin, alpha 1, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:87902]
actin, alpha, cardiac muscle 1 Gene [Source:MGI Symbol;Acc:MGI:87905]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4881
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080664 Nonsense 86 377 3 8
Genomic Location (Zv9):
Chromosome 20 (position 10158056)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9989985
GRCz11 20 9977225
KASP Assay ID:
2261-4013.1 (used for ordering genotyping assays)
KASP Sequence:
TGAAGTACCCGATTGAGCACGGCATTATCACCAACTGGGAYGATATGGAG[A/T]AGATCTGGCACCATACCTTCTACAATGAGCTGCGTGTGGCCCCTGAGGAA
Associated Phenotype:
Not determined