Busch Lab

ZMP

si:dkey-33c12.4

Ensembl ID:
ENSDARG00000057890
ZFIN ID:
ZDB-GENE-030131-2527
Description:
si:dkey-33c12.4 [Source:RefSeq peptide;Acc:NP_001155071]
Human Orthologue:
TTC31
Human Description:
tetratricopeptide repeat domain 31 [Source:HGNC Symbol;Acc:25759]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35424 Nonsense Mutation detected in F1 DNA Not yet available
sa42140 Nonsense Mutation detected in F1 DNA Not yet available
sa22229 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35424
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083362 Nonsense 4 631 1 18
ENSDART00000144146 None None 170 None 6

The following transcripts of ENSDARG00000057890 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8732848)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9035468
GRCz11 13 9367491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAATACAGTATTATATCAAATATAAATATATTCGTGATAATGTCAATAT[C/A]AAAAAAGCATACCATAGGACCAGGTGAGTGTTGTTAGGCTCTTTTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42140
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083362 Nonsense 263 631 8 18
ENSDART00000144146 None None 170 None 6

The following transcripts of ENSDARG00000057890 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8721438)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9024058
GRCz11 13 9356081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGAAACCTAAACCTGACAAGAAGCCTGCTCAAGCAAACCCAAAAAAA[C/T]AACACGAATCCCAGCAGAAAGCCACTGTGATGCCTCAAAAGCAGGTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22229
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083362 Essential Splice Site 497 631 14 18
ENSDART00000144146 None None 170 None 6

The following transcripts of ENSDARG00000057890 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8710533)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9013153
GRCz11 13 9345176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCTCGACCCAGCATGCCAACCGCTGCTCCACTTCCCCCTCATTCCCCG[T/C]AAGGCGCACACACATATCCCAGCAATCATGGTACATAACCATTTACCCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2695
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083362 Nonsense 594 631 18 18
ENSDART00000144146 None None 170 None 6

The following transcripts of ENSDARG00000057890 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8706114)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9008734
GRCz11 13 9340757
KASP Assay ID:
554-2910.1 (used for ordering genotyping assays)
KASP Sequence:
CAGTTTATTAATAAAATAACAACTTTTATTGTTTTGTTTTTTTCAGCAAA[C/T]AGCCTAATGAATGTTATTTTTGGAGGATGTATGGCTGTAAGAATGAACGC
Associated Phenotype:
Not determined