Busch Lab

ZMP

ANKRD6 (2 of 2)

Ensembl ID:
ENSDARG00000057790
Description:
ankyrin repeat domain 6 [Source:HGNC Symbol;Acc:17280]
Human Orthologue:
ANKRD6
Human Description:
ankyrin repeat domain 6 [Source:HGNC Symbol;Acc:17280]
Mouse Orthologue:
Ankrd6
Mouse Description:
ankyrin repeat domain 6 Gene [Source:MGI Symbol;Acc:MGI:2154278]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa23030 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23030
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080526 Nonsense 668 691 14 14
Genomic Location (Zv9):
Chromosome 17 (position 15598636)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15749464
GRCz11 17 15757397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGGAGACACAGAGATCCGCAGAACATAAAGCTCTGCAGGACAGAAGC[A/T]GACTGATGGAGAAGATCAGCTCGCTGGAGGAAGAGCTCAGGAGGCTTCGC
Associated Phenotype:
Not determined