Busch Lab

ZMP

ITGAE

Ensembl ID:
ENSDARG00000057787
Description:
integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) [Source:HGN
Human Orthologue:
ITGAE
Human Description:
integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) [Source:HGN
Mouse Orthologue:
Itgae
Mouse Description:
integrin alpha E, epithelial-associated Gene [Source:MGI Symbol;Acc:MGI:1298377]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa35847 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16148 Nonsense Available for shipment Available now
sa42515 Nonsense Mutation detected in F1 DNA Not yet available
sa22611 Nonsense Available for shipment Available now
sa35846 Essential Splice Site Available for shipment Available now
sa35845 Nonsense Mutation detected in F1 DNA Not yet available
sa30990 Nonsense Mutation detected in F1 DNA Not yet available
sa12794 Nonsense Available for shipment Available now
sa22610 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35847
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Essential Splice Site 10 1266 2 35
Genomic Location (Zv9):
Chromosome 15 (position 16232399)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17277362
GRCz11 15 17213384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAATAACTTCGTTCTGAGTAGTGTTTCCACTCATTATTTGGTGTTTTAC[A/T]GTACTGTGTAATGCAGCTGGGTTTAACATTCAAATATCTCCAGTGAAACA
Long Flanking Sequence:
AATTACTTTTTACATTTGGGTGAACTATTCCCAGGGCTCCTATTTCAGAACTGATACAGTTTTTGAAAATAAAGATGTTTTAAAATTCAGAATAATAATCTACTTACTCTGGGTTCAGCTTTACACAAGAGAAAATATGCAGTGTCTGCAGTTTGTGAAGGGGGAGGGTTTGACAGTCAGCAGTAAATGAGTGCTGTTCTGCTTTCTCAAGACCAAAACAAGCTGCTTTGTATCTCGATGTGTCAATGTGTTTTCTTTAAAGAAAATTGATATTGATCAATCTACACAAAAATGTACAGAAAACTGCTATTTGTGATGGGTATGTATTGATTTACAGTGTTAAATATACTGTATATTTGTGTTTATAATATTGTTTGAAAACATGTTGCGCTTGTTTTAAACTCAAGCAAAAGATAAAAAAAATTAAAATCATAATGAATTCAATTTATCTTAATAACTTCGTTCTGAGTAGTGTTTCCACTCATTATTTGGTGTTTTAC[A/T]GTACTGTGTAATGCAGCTGGGTTTAACATTCAAATATCTCCAGTGAAACATTTCACAAATGAGGATCCACTCTTTGGCCAAACCATCATTCAGGCAAAAGATGGGTTGGTAATTCTAAACATATAATTTTTTATTTAATTTTATTTTAGATGTGTTCTGTAACATGTTACTGCTTTGTTCTGTTCTAGAATTTTTGTTCCCTCCCCAACATATGGAAGACTTTTCAAGTGCACTCTAGACAATGAATGCACCAAAGTAAACATTAACGGTAAGTTTATCTTTGCCTTTTTTTTTTATAACAGATCATTTGCAGAAATATAATGTTATTTTTTTAATATAATGTTATTACTTATTTACAGAATTAAAGAGATGTTTCAAAAAAAAAATTTAATTACCTCATCATTTACTCACACTCAGTTGGTTCTAAACAGTTTTCAATTCTTCTGCTGAACACAATTAAAGATATACTAAAGAATGTTGAAAAAACTGCTGTGGATTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28425
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Essential Splice Site 94 1266 4 35
Genomic Location (Zv9):
Chromosome 15 (position 16231675)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17276638
GRCz11 15 17212660
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCAGTAGCATCAGTGGCTAGCCTGACATCACAGGAACAACATGTTGTG[G/A]TATGTACAAACACTAGGAGGTCTTATATGATTGGACAACATTTCCTTTAT
Long Flanking Sequence:
TCAAGTGCACTCTAGACAATGAATGCACCAAAGTAAACATTAACGGTAAGTTTATCTTTGCCTTTTTTTTTTATAACAGATCATTTGCAGAAATATAATGTTATTTTTTTAATATAATGTTATTACTTATTTACAGAATTAAAGAGATGTTTCAAAAAAAAAATTTAATTACCTCATCATTTACTCACACTCAGTTGGTTCTAAACAGTTTTCAATTCTTCTGCTGAACACAATTAAAGATATACTAAAGAATGTTGAAAAAACTGCTGTGGATTTCAATGGTTGTTTTTTCAAACATACTTCAGTATCTCTTCCTTTTTGTTCAACAGAAAAAAGAAACTAAATAATGACAGAATAAAAACTAATTGGAGTGAACTAACCTTTTAAGCAGAATTGTAAAAATGTTTTACATAAATGTCTCTTTTAAAGATGAGAACCCAAAAGGCATGAGACCAGTAGCATCAGTGGCTAGCCTGACATCACAGGAACAACATGTTGTG[G/A]TATGTACAAACACTAGGAGGTCTTATATGATTGGACAACATTTCCTTTATTCTCAATGTGATTATAGTACTAAAAGGTTTAGCTACTAACTGAGAAGTAATAGTAGTCTTAATATATGCATAATCAGATATAGTTTGCAAAATTTTGTGTCTGTTGCACAGCATTTTCAGAGTAAAACCCCAAAAAACTGTGGTTTACTCCTCACACATGTGACAGACTAAAATGTATCAGTTTTTGTTCACAGTATAGTAAAAGTTGTCATTGTGAAAGTTGGAAAATTAGTTTGTAAAATGTGAAACATAACTAGAAATTGTTATTTTAGGGGAATTGTATTAGTTTTGATTTGTTGAGAAGTTGGGAAATTGTTCAGGATGACGTGACTATCATGAGAAGGTCATCAAGGCTTAGAGTTACAAACGTGGCATCATTTGAAGCCATAGTGAAGGCACCACTAGGAATATCTGGTGTGCTGTCTGGGGAGAGGGCTTTGAGCTCGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16148
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Nonsense 189 1266 7 35
Genomic Location (Zv9):
Chromosome 15 (position 16229641)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17274604
GRCz11 15 17210626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAYTTTCAGAAAGCGAAAGACTTCATCTACAATGTCATGTCCAATGTTT[G/A]GAAAACATGTTTCGATGCAAGTATAAAGAAAAAAAAANNNTCATGGCACAAAA
Long Flanking Sequence:
ATGTGTAATCAAGTTAGAACAGAGAACAGAGGAACTGAGTATTTGAATGGAATTTGCACACTTGTGAGTCCTTCTGGAAAAGTCAAACTATATCCTGCTGAATTAGGTATGTTTGGTGCATTTACTATGGGGTCTTCACATTCAACCAGATAAAATCTTATACCTGAAATTCCTAAATCTCTTTTTTCAAGACAACAACAAAAACAACAACAACAACAACAACAACAACAACAACAAATACCAAGGTGGAAGGATCAATCAAGGTGAGACTGTCTTAAGGAAAATGTAGATAGTGTTGAATTTATTTATAATGCATGATAATTAATAACGTATGGAGGGAAAAAACATAAAATGTGCCAGAATAAGCCAGGATGGCTAATTTACATCTTTCTTAGGTCCTGGGACAGAGATTGCTTTCGTTCTGGATGGTTCTGGCAGCATTCAAGATGATGACTTTCAGAAAGCGAAAGACTTCATCTACAATGTCATGTCCAATGTTT[G/A]GAAAACATGTTTCGATGCAAGTATAAAGAAAAAAAAATCATGGCACAAAATACAATTCAATTGATATTAACTTTACATTAACCCCTCTTCTCTCTGCAGTGTAATTTTGCAATAGTGCAATACGGTAGTTTGATCAGAACTGAGCTCTCGTTACTAGACAATGAGGATCGCGTGGGATCCTTGCTAAAGGTCAAACAAATAAAGCAAATTTACAATCTCACAAAGACGGCCTCTGCCATCAATCACGTCCTGTGAGTCTACAAACAATTTTTACAGCATTTGGAGATGACTTAATGGTGTGATTTTACAATGTTGTGGTTGATTACAGCACAGATATCTTCATCCCTGAGAATGGATCAAAAGATAACTCTGCAAAAATAATAATCGTCTTGTCTGATGGAAAGATTCTGGGAGACCCTATGACTCTTGATGAAGTTTTGAACAAGCCCCAAATGAAAGGTGTCACTCGCTACTCCATAGGGGTAAGTGTCCCATTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42515
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Nonsense 254 1266 9 35
Genomic Location (Zv9):
Chromosome 15 (position 16229287)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17274250
GRCz11 15 17210272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTACAATGTTGTGGTTGATTACAGCACAGATATCTTCATCCCTGAGAAT[G/T]GATCAAAAGATAACTCTGCAAAAATAATAATCGTCTTGTCTGATGGAAAG
Long Flanking Sequence:
TGCCAGAATAAGCCAGGATGGCTAATTTACATCTTTCTTAGGTCCTGGGACAGAGATTGCTTTCGTTCTGGATGGTTCTGGCAGCATTCAAGATGATGACTTTCAGAAAGCGAAAGACTTCATCTACAATGTCATGTCCAATGTTTGGAAAACATGTTTCGATGCAAGTATAAAGAAAAAAAAATCATGGCACAAAATACAATTCAATTGATATTAACTTTACATTAACCCCTCTTCTCTCTGCAGTGTAATTTTGCAATAGTGCAATACGGTAGTTTGATCAGAACTGAGCTCTCGTTACTAGACAATGAGGATCGCGTGGGATCCTTGCTAAAGGTCAAACAAATAAAGCAAATTTACAATCTCACAAAGACGGCCTCTGCCATCAATCACGTCCTGTGAGTCTACAAACAATTTTTACAGCATTTGGAGATGACTTAATGGTGTGATTTTACAATGTTGTGGTTGATTACAGCACAGATATCTTCATCCCTGAGAAT[G/T]GATCAAAAGATAACTCTGCAAAAATAATAATCGTCTTGTCTGATGGAAAGATTCTGGGAGACCCTATGACTCTTGATGAAGTTTTGAACAAGCCCCAAATGAAAGGTGTCACTCGCTACTCCATAGGGGTAAGTGTCCCATTTACTGCAAAGTTTAGATAATTTTAGATAATCCAGACTGATCTCAATGGAAAACATAACTGTTTTATAAAATATGAATATGAAAATGTATTATTTTTAAAAGAAGTCTTGACCCAAATTCTACACCCATATCAAACTGTCATTGGGAATGAGCAGTTTGTACTAAAATGTTATGAGATCATATGAACATCAAAAGTTATAAATTGCATTGAGATTGTATTGGATAATCCCAATTTTACATCATATGTTGGAGCAACAACTGCAAAAAAAGTAATCTGTAATCATAGATAACTCTGGTTCCCCTTCGGTTGGGGAACTTCAGTGCTATAAAGTGGATTTGATCTTGGAAAATCCACTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22611
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Nonsense 288 1266 9 35
Genomic Location (Zv9):
Chromosome 15 (position 16229185)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17274148
GRCz11 15 17210170
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGGGAGACCCTATGACTCTTGATGAAGTTTTGAACAAGCCCCAAATG[A/T]AAGGTGTCACTCGCTACTCCATAGGGGTAAGTGTCCCATTTACTGCAAAG
Long Flanking Sequence:
TCAGAAAGCGAAAGACTTCATCTACAATGTCATGTCCAATGTTTGGAAAACATGTTTCGATGCAAGTATAAAGAAAAAAAAATCATGGCACAAAATACAATTCAATTGATATTAACTTTACATTAACCCCTCTTCTCTCTGCAGTGTAATTTTGCAATAGTGCAATACGGTAGTTTGATCAGAACTGAGCTCTCGTTACTAGACAATGAGGATCGCGTGGGATCCTTGCTAAAGGTCAAACAAATAAAGCAAATTTACAATCTCACAAAGACGGCCTCTGCCATCAATCACGTCCTGTGAGTCTACAAACAATTTTTACAGCATTTGGAGATGACTTAATGGTGTGATTTTACAATGTTGTGGTTGATTACAGCACAGATATCTTCATCCCTGAGAATGGATCAAAAGATAACTCTGCAAAAATAATAATCGTCTTGTCTGATGGAAAGATTCTGGGAGACCCTATGACTCTTGATGAAGTTTTGAACAAGCCCCAAATG[A/T]AAGGTGTCACTCGCTACTCCATAGGGGTAAGTGTCCCATTTACTGCAAAGTTTAGATAATTTTAGATAATCCAGACTGATCTCAATGGAAAACATAACTGTTTTATAAAATATGAATATGAAAATGTATTATTTTTAAAAGAAGTCTTGACCCAAATTCTACACCCATATCAAACTGTCATTGGGAATGAGCAGTTTGTACTAAAATGTTATGAGATCATATGAACATCAAAAGTTATAAATTGCATTGAGATTGTATTGGATAATCCCAATTTTACATCATATGTTGGAGCAACAACTGCAAAAAAAGTAATCTGTAATCATAGATAACTCTGGTTCCCCTTCGGTTGGGGAACTTCAGTGCTATAAAGTGGATTTGATCTTGGAAAATCCACTTATGGGAGGATTCGGTTCAGAAGCCGCTTGTCTGAAAGAGTATTGAACAGGCCAATGAAAGCAATGAATTTGAAGCGTAAGCTTGCGCAGGTGCGCTTCAATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35846
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Essential Splice Site 557 1266 15 35
Genomic Location (Zv9):
Chromosome 15 (position 16205981)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17250944
GRCz11 15 17186966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAATTACAGCTCGCTGAAGCTGGATTCAGCTCCCATCTCTTATACAAC[G/A]TAAGTATGATCGTTTCAAAAGACTTTCTGGTTTGTTTTCATCATGAACTT
Long Flanking Sequence:
ACACTCATAAGCTACTTTGTAGTTAATTGCAATTGTAATTAAAAATGTATAATAAGTTCCATACACTTACATCCTCATGTTACCTTTAGGTTGGCGATGGCATCCTGAAAAACAAGGATGCAATCAAAGAGATGACGCAAATAGCAGATCCTGGAAAGTATTATAGTGTTTCCAGTTATGGCGCATTAAATGATATTCTGTCCTCACTGGAAAGAGGGATAATTGGAACTGAAGGTATGAAATGTACAAATTACACTGAATAATAACCCTTATAGCCACGAAAAAAAAAATCCCAACAACTACAGTGCAAACTGAATACCTGTCTAGAGTGCACACATGGGCAATAGCCTCTCACATTTCACATGACTTGAGATGATATTTGTAATTGAATAGTCACTGTATCATTATTGTTTGTTAATAAACTTTGTGTGTCAGGCACTCAGCATGGATTTAAATTACAGCTCGCTGAAGCTGGATTCAGCTCCCATCTCTTATACAAC[G/A]TAAGTATGATCGTTTCAAAAGACTTTCTGGTTTGTTTTCATCATGAACTTGTACTCTTTCTTTCTGACACTGTATGTTAAATCTTGTGTTATATAGTATATTTATATCCGCAGCGTCTTTTCATGATGATTCACATACTGTTAACATTGTTTTGTTTTTGTACAGGAGCAGAAGGTTGAAGCACTATTTGGAGCTGTTGGAGCTTATGACTGGAGTGGTGGGGTCTTTTTGAAATCCGGCAACACGGTTAAATTCTTGAATGATTCTCACAATGAAACCAAATTTGGATATTTAGGTGAGTGATAATATACTATTCCCAAGTGATTGAGAGTAAAGATGTTCTCTTAATGTTCTCAAAAGTAAAGATGATGTGAAACACTGTTAAACATGCCTTTATCCCAATGTTTTTGTCGCCATTAAAATCTAAATGTATTCTTAACATTAGAAATCTTTTATTCCCAATTCTGTTCATTAAAATAAAAGTTAAAGGTCCTGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35845
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Nonsense 645 1266 18 35
Genomic Location (Zv9):
Chromosome 15 (position 16204120)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17249083
GRCz11 15 17185105
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCCAGTTTGCAAATGTAAATTTGATAATCAATAAATGATGTTTAGGTT[G/T]GATCTTACTTTGGATCGGTTCTTTGTGCCTTGGATATTAATAAGGATGAA
Long Flanking Sequence:
ATTTGATGGCTTAGAAAAGTATGTGCTTCACGGAGATCAGGTATTTGTAGTTAATTATTATTAACATATCCGACTACTTTCATTTTCAAATGGTTTTATTTTATATATACACAGTTAATGACAAAAACTTAATCCTCCAATGACATTTGAATTATTTGTCATTATTTTCCAACCTTAATGTCCAATGACCTATTAAATAAGCTTCTCTAGTAAATCTAAAAAGCCTGTTTAAGTCTTTAAACTGCACTACAGTGAATATCTTACTAAATTACTAGTACAATATTATATAACCGTAATATGTACTGTATCATGGCAAAGAGAAAACAAATTATTAGAAAATTTTGCAATATAATGATAATTGTGCTAATAATTTTGTCTTCAACTGTACATTTTGTCACTAAAATGAAATCTTTAAATGGCATTCACAGTACACATTCATAATAAAACCAAGCCCCAGTTTGCAAATGTAAATTTGATAATCAATAAATGATGTTTAGGTT[G/T]GATCTTACTTTGGATCGGTTCTTTGTGCCTTGGATATTAATAAGGATGAACACACAGATCATCTATTAGTTGGAGCTCCACATTTCCATCTGAATGGGGAAGAAGGCAAAGTGCTAGTGTACAAACTGAATCAAGTAAGACTATTGTTTTATGTGTGACTGCATTAGCATGAATAATAGCTAACGGTCTTGTTTTTCTCTAAGGAGGACAGGTTTGAACGTGCGCCCGTGGAGCTGCGGGGTGATGCAGGACAGACCTTTGCCAGGTTTGGTGCAGCCATTGGCTCTATTGGAGACATTGATAACAACAAGTTTAATGATGTAGCAGTAGGTGCTCCTCTGGAAACAGGCTCAGCTGGAAGCGTTTACATCTACAGTGGTTTCGAAGAAGGTCTTCGCTTTTCACAAGTGAGTTTAAGCATGTGTGAACTTGGACCGCAAAATTAATTAAATTAAGATTTATACACCTGAAAGCTGAGAGTATGGTTTGTTAAAACAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30990
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Nonsense 854 1266 22 35
Genomic Location (Zv9):
Chromosome 15 (position 16199623)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17244586
GRCz11 15 17180608
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATAACCACATTTCACTTCCTGTTGTTTTAGCTGAAAAATCTGAAACA[C/T]AGGCTGTTGACTATGAAATTGACTTGGATTCTGGTGCAAGCAAAAAGCGC
Long Flanking Sequence:
CATGTGGTCTCCCATCCAAGTACTGACCAGGCTCAGCCCTGCTTAGCTTCAGTGAGTAACCGGTCTTGGGCTGCAGGGTGATATGGCTGTGGAATTAGGGAAAATGGAAACAACTAAAAAAAAAAAAAAAATCACAGGGTTGACTTCAGCTGTACATTACTCTATTTTTCAATGTGACCGAATTTCTCATTATGTTTGAGTATACGTTCAGATTTACTATAGGATAGTTGAACCAGTTTTTTGACTGTATTATGTTTTACAGAACTATCCCAGTCTTGATTATCGAACCAACTATCAAAATTGATACAGAAGTCATTGCTCTCACTCACCAGATGAATAAAATATCCAGCGAGTTAAGCATGAAGATTACTGTTTGCTTTAACATAAAAAAAGGAAAGCTTAAGGGTAAGTGAGTTTAAGATCGCCGAAAATATTTGATGCTCATGTTCTATTATAACCACATTTCACTTCCTGTTGTTTTAGCTGAAAAATCTGAAACA[C/T]AGGCTGTTGACTATGAAATTGACTTGGATTCTGGTGCAAGCAAAAAGCGCCTCACTTGCGGCGCAGACAGCCTAATAAAAGACACTTTTACTCTGACACCAGATGAAGAGTGCACTAATAAGAAGCTAACATATTTGGTATGTTGGTTCATTTAATTATTTTTTTTTTCATGTAAAAAAACTATATAGCAATGTAAACCGACAATCAGCTTGAATTTACTGTTTCAAATTGTCAGTGATTATCACAGTGTTTTTGTCTGAGAGCTATGACTCTTATTTTGTCATATTAACTGAGACGAGCTGTGTTTTCCTTTCAGGGCTGCTTTGATTGTTTTTCACCTATTAAAATCAAGCTGAGTTTTTCATTGGCATCCAACAAAAATGAAGCACCTATTCGCATTCTTGATGCATTTACTCCAACAGAGGTTGTAAAAGAGGTAACCTTTTATTATTATTATTATTATTATTATTATTATTATTATTATTAATAAAATACAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12794
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Nonsense 916 1266 23 35
Genomic Location (Zv9):
Chromosome 15 (position 16199257)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17244220
GRCz11 15 17180242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGCTGCTTTGATTGTTTTTCACCTATTAAAATCAAGCTGAGTTTTTCAT[T/A]GGCATCMWACAAAAATGAAGCACCTATTCGCATTCTTGATGCATTTACTC
Long Flanking Sequence:
TTACTGTTTGCTTTAACATAAAAAAAGGAAAGCTTAAGGGTAAGTGAGTTTAAGATCGCCGAAAATATTTGATGCTCATGTTCTATTATAACCACATTTCACTTCCTGTTGTTTTAGCTGAAAAATCTGAAACACAGGCTGTTGACTATGAAATTGACTTGGATTCTGGTGCAAGCAAAAAGCGCCTCACTTGCGGCGCAGACAGCCTAATAAAAGACACTTTTACTCTGACACCAGATGAAGAGTGCACTAATAAGAAGCTAACATATTTGGTATGTTGGTTCATTTAATTATTTTTTTTTTCATGTAAAAAAACTATATAGCAATGTAAACCGACAATCAGCTTGAATTTACTGTTTCAAATTGTCAGTGATTATCACAGTGTTTTTGTCTGAGAGCTATGACTCTTATTTTGTCATATTAACTGAGACGAGCTGTGTTTTCCTTTCAGGGCTGCTTTGATTGTTTTTCACCTATTAAAATCAAGCTGAGTTTTTCAT[T/A]GGCATCCAACAAAAATGAAGCACCTATTCGCATTCTTGATGCATTTACTCCAACAGAGGTTGTAAAAGAGGTAACCTTTTATTATTATTATTATTATTATTATTATTATTATTATTATTAATAAAATACAGTAAAAATAATCACCCATTACTACTAGTATGGATATAATGGATATACTGAAATTTTTATAATTTTTAATGATGAGAGAAATGCAACAAAATATTTCTAATTTACTTATGTAAAATGGAAAAATACTTTTATATAACAGTGACGTATGTTTTTTTTTTATTAAAGAGTTAAAAATCTTCAAAAATATTTTTGATACTTCATCATCAGGGCTGATTCTGATAAAGAAGTCTTTGAGAAAGCAGAAAATAAATGAATACAGTATATGATCATTTTTGACAGTTTTTGACAGACATTTTTGTTTTCTAAGGACTTACCACAAGGGTAAACATTATAAATGTCTTATTTTATAATCAGTAGTAATTGTGTCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22610
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080523 Essential Splice Site 1005 1266 26 35
Genomic Location (Zv9):
Chromosome 15 (position 16197505)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17242468
GRCz11 15 17178490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCACAGTTGCATTTAACAGAGAGTCCTGACGAACTGTGCTCTGCAAAC[A/C]GAAAATTGAAGGAGCCGCCTGTCCTGTGAAGAATGACAATCAGATTCAGT
Long Flanking Sequence:
GTGTTTGTGTTAGTAAAAACAATAACTAACAGTAAATGTCCTGTATCATGAAGTGTTACCAATGACTTAGTAAATGATCAGAAATTTCAATTTGTTTTCATTAGATTCCATTTGAAAAGGACTGCCAGGCTGCAGATTGTAAACCTAGCATTACATTATCTGATTCAAAAATAAGGTACGTACTGATCAAATTCTAGTCTTTATCTAGTTAACTTCATTTCCGTTTTAGGAGTGTACGTATTTATAAGACATGTAAAAGTATATATTTTCTTGTAACTAAATGTATATTAATATTGCAGTGAAACCACTATCACAATGGGAGAAACGCAAAACCTGAATATCAATTTCAATTTCACCAACACTGGAGACCCTTCCTACAAGACCACCCTGACGTTGACGTACCCCAGCATACTCAGTGAGAGGGTAAAAAAAAAAAACACTCACAGCTCTTCTCACAGTTGCATTTAACAGAGAGTCCTGACGAACTGTGCTCTGCAAAC[A/C]GAAAATTGAAGGAGCCGCCTGTCCTGTGAAGAATGACAATCAGATTCAGTGTCATCTTCAACACCCGGTTTTCACAAGATCTGCACAGGTAAAAAATCTCACATCACATCTTTGAAATATTACCATTCTCATTTGTACCTTTTGTTTTATTTATTTTGTTAATTATTTTTCCAGACCAATCTCTTCATCTCCTGGCAACTTAATGACAAATCTGATCTCAAGAAGTCTGAGATTATAGCAAATCTTACCAGGTTTGAATGCTGGCTTGAACATTACTCTGGTTTTTGAACATCTGAATATAGTATTTCATCTGTTTTTATTGTTTATTTTTCTTTTTTTTAGTCAGAATAATGGCATTCAGCTTCTGGACTCTAGAATATATACGTTTAATGTGATGTATTTCCTACCAATTCTTATACGTGGGTGAGTAAACAAACAACCTGTGAATTATTTTACATAAAACCTATTGCTTTTGTAATATTGATTCATATATTATTATT
Associated Phenotype:
Not determined