Busch Lab

ZMP

march7

Ensembl ID:
ENSDARG00000057772
ZFIN IDs:
ZDB-GENE-080204-121, ZDB-GENE-080204-121
Description:
E3 ubiquitin-protein ligase MARCH7 [Source:RefSeq peptide;Acc:NP_001108052]
Human Orthologue:
MARCH7
Human Description:
membrane-associated ring finger (C3HC4) 7 [Source:HGNC Symbol;Acc:17393]
Mouse Orthologue:
March7
Mouse Description:
membrane-associated ring finger (C3HC4) 7 Gene [Source:MGI Symbol;Acc:MGI:1931053]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa30623 Nonsense Mutation detected in F1 DNA Not yet available
sa40644 Nonsense Mutation detected in F1 DNA Not yet available
sa10385 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3597
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090366 Essential Splice Site None 179 None 15
ENSDART00000126243 Essential Splice Site 61 768 None 11
ENSDART00000129198 Essential Splice Site None 179 None 9
Genomic Location (Zv9):
Chromosome 6 (position 11711170)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11564796
GRCz11 6 11800223
KASP Assay ID:
2259-7261.1 (used for ordering genotyping assays)
KASP Sequence:
AGATCGCTTTAGCAGAGACGCTTCTGTCAAATTAGACTCTGACTATCAGG[T/A]ATTACAGTGACACATTCATTTCCCGACTCTGTCCACATGCCCGGGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30623
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090366 None None 179 5 15
ENSDART00000126243 Nonsense 235 768 5 11
ENSDART00000129198 None None 179 5 9
Genomic Location (Zv9):
Chromosome 6 (position 11703065)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11556691
GRCz11 6 11792118
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATTTCTTTTTGTGCTTCAGATCGTTCAGAACGTGTTGCTTCTACCTA[T/A]GCACAAGGTGCTCGACCCAAAGATAGCCAGTACTCGTCCCACAGAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40644
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090366 Nonsense 27 179 5 15
ENSDART00000126243 Nonsense 567 768 5 11
ENSDART00000129198 Nonsense 27 179 5 9
Genomic Location (Zv9):
Chromosome 6 (position 11702071)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11555697
GRCz11 6 11791124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGTTTGCCTGAGAATGTGTTGATTGGTGTTGGAGTCGAGGGGAGGAGT[C/T]AAGCTGATGAGCAGCCCAAAGACAAGCCTGCCCCATCCAGAGACCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10385
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090366 Nonsense 54 179 6 15
ENSDART00000126243 Nonsense 594 768 6 11
ENSDART00000129198 Nonsense 54 179 6 9
Genomic Location (Zv9):
Chromosome 6 (position 11698753)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11552379
GRCz11 6 11787806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTCTTTTGTGTATCGACCTCACATTGCTTCTTGCTTTTAGCCTGCTGT[T/A]GGAGGAATCTGATGAGGARGAGGGTGATCTGTGCCGAATCTGTCAGATGG
Associated Phenotype:
Not determined