Busch Lab

ZMP

zgc:114140

Ensembl ID:
ENSDARG00000057736
ZFIN ID:
ZDB-GENE-050913-43
Description:
Anoctamin-10 [Source:UniProtKB/Swiss-Prot;Acc:Q4V8U5]
Human Orthologue:
ANO10
Human Description:
anoctamin 10 [Source:HGNC Symbol;Acc:25519]
Mouse Orthologue:
Ano10
Mouse Description:
anoctamin 10 Gene [Source:MGI Symbol;Acc:MGI:2143103]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39079 Nonsense Mutation detected in F1 DNA Not yet available
sa5886 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39079
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104168 Nonsense 102 642 3 14
ENSDART00000126041 Nonsense 102 646 3 14
Genomic Location (Zv9):
Chromosome 16 (position 9216459)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8076628
GRCz11 16 7994872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGCTTGTTTAAGGAGTTTCAAGATGGCACAATGCGCGGGTTCACTTA[T/A]GCCAACAGAGAAAGCTTCAAAGACTTTGAAGGTGAGGTCCAAGTCGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5886
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104168 Nonsense 201 642 6 14
ENSDART00000126041 Nonsense 201 646 6 14
Genomic Location (Zv9):
Chromosome 16 (position 9220302)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8080471
GRCz11 16 7998715
KASP Assay ID:
554-3738.1 (used for ordering genotyping assays)
KASP Sequence:
ATAGTATGCTAAAGCCACTGTGCTGTWYTCTTCATGGTGTAGATGACATC[A/T]GAAGTTACTTTGGTGAAGGTCTGGGACTCTACTTTGGATTTTTGGAGTAT
Associated Phenotype:
Not determined