Busch Lab

ZMP

atl2

Ensembl ID:
ENSDARG00000057719
ZFIN ID:
ZDB-GENE-030131-6505
Description:
atlastin-2 [Source:RefSeq peptide;Acc:NP_001103492]
Human Orthologue:
ATL2
Human Description:
atlastin GTPase 2 [Source:HGNC Symbol;Acc:24047]
Mouse Orthologue:
Atl2
Mouse Description:
atlastin GTPase 2 Gene [Source:MGI Symbol;Acc:MGI:1929492]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42136 Nonsense Mutation detected in F1 DNA Not yet available
sa44782 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42136
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Founder:
SL7_04_D9
KASP Assay Location:
Unknown
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080460 Nonsense 187 606 3 13
ENSDART00000127841 Nonsense 205 624 3 13

The following transcripts of ENSDARG00000057719 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 7657612)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7962132
GRCz11 13 8294155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACGGGAATCCAGGCTTGGAGCGAAGTATTTGTTGTGGAAAAGAAAGAT[G/T]GAACTAAGGTGGATGGGCATTCATTTAAAGTGTTATGTTGCCGTGAGGTT
Long Flanking Sequence:
AAATGCATTAACTAATGAACCATTATTTATAATGTTATCCACTTATTGTTAATGTTATTCACACATTCGTATCATAATAATCACTAGAAGGAAAAAAAAACATGTATTGGCCTTTTTTGTGAGGACTGTAAAATCACTTGTCGGCTACCATTTTCCATTATGATGTTTCCTCCAACACATCAGTTAAGAATAAGTCTATCTGATTTACCATTCCTGAGAACAGGTTTCTGATGACTCCAATCTTTCACATGCCTTAACTTGCGGGTTGCGTCCTGCATCTTGAAAACCAGCTAGGTCACATGAATGTGAGCATACATGTTTTATTACATTCATTTAGAGCAATCACATGAACTGTCTCTTTTGTCCCTTTGTAGTCAGCTGAGTCATGGATAGGAGGAGATGATGAGCCATTGACCGGTTTCTCCTGGAGGGGTGGCTGTGAGAGAGAGACCACGGGAATCCAGGCTTGGAGCGAAGTATTTGTTGTGGAAAAGAAAGAT[G/T]GAACTAAGGTGGATGGGCATTCATTTAAAGTGTTATGTTGCCGTGAGGTTATGTTGACTGTGTGATTACACATATCTCTGTGATGTTAGGTGGCTGTGCTGCTGGTGGACACTCAGGGAGCCTTTGACAGTCAGTCCACTATCAAAGACTGTGCCACTGTTTTTGCTTTAAGCACCATGACCAGCTCTGTGCAGGTGCGTTAAAACATATCAGGGATGTTCAAGGACTGAATAATTCATGGCATTCAAATGACTTCTTGATCTTGTTTGTTTTAGGTTTATAATCTTTCTCAGAATATCCAAGAAGATGATTTGCAGCATCTCCAGGTAGCAACTTTATTAGTGTACATTGTTAGTTAGTAGTGTGTTAGTATTGTGTGTATATGGGACTGTAACATCATCTGTCTTTTATAGCTTTTCACAGAATATGGTCGACTTGCAATGGAGGAGATCTACGAGAAGCCATTTCAGGTAGAAAAGCTGATCATTTCCATTTTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44782
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Founder:
SL6_11_E8
KASP Assay Location:
Unknown
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080460 Essential Splice Site 380 606 9 13
ENSDART00000127841 Essential Splice Site 398 624 9 13

The following transcripts of ENSDARG00000057719 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 7651546)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7956066
GRCz11 13 8288089
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCGGTGGAGCTAAAGTCACATGCAGAGATCTGGTGGAGTACTTCAAGG[T/A]CAGATTTCATTACTTTAGCCGCAGCAGCTGTAAACACAAACCAGATTAGC
Long Flanking Sequence:
GTTCAGTTCTCTTTCCATCTGTAAGAGAACATCAACAATAAAAAAAAGAAAAACATTTCAAGAGTGCATTTAATACAGGTTTATTATATTACTAATTATTAATATTGTATTAATTATTATGTCATTATTATTAGTAATGTTTTTTTTTTTTTTTTTTTTGCATAAATAGCACTTCCTCAGCAATGGTTTCATGGATTGTTGAGAATGCATTTTAGGTGTTCAATATGTTGCGTGTCAGTCATGAAATAATAATAGGGGCTGGAAAAAAAGTGCTTTAAATTCCTTGATTTTCATTAAGTTGTGCCTGTATTAATCCTGGATTTACATTATTATGCTTTTTTTTTTTTAATTTTATTCATTTATTTTTGCAGAGATTGATGATGAGTTCAAGAGGGAGCTGCAGAATCTAGTTCCTTTACTGCTGGCACCAGAGAACTTGGTAGAGAAAGAAATCGGTGGAGCTAAAGTCACATGCAGAGATCTGGTGGAGTACTTCAAGG[T/A]CAGATTTCATTACTTTAGCCGCAGCAGCTGTAAACACAAACCAGATTAGCTGTTAATTGTGTTAAGATTTAAACAGAAGAGACTCTGTTCAGGTGTTTTTGTAGAGTTTATGATGTGATGAACGTCTTTTGGTGATAATAAATGAAATTAACATTCATTTAGTTATTAATCATAGACAATTCTTAAGGCAAAATATATGGTGCATGTAGAAACTGACAGTGGCCTATTAACTGATACCAAGCTGCAAGAAATGTTCTTGACACTACCTGTTTTAGCTCTGGTTTGTTATCGCAACAGTTTATTAAAAATTATTCTGCCAAAGCAGGCCTGTTAAAGCTGAAGATTGGCTGAGGGAAAGCTGGATATCTTCAGATTAAGACATTTTAATTTTTCTCTCATTGAGATACAACACCACCAAAGCTTTCTACAAAGGCATGCTACAAATCAGTTACACACAGCAAAATAGATGCATAATCTACGTGGATTTGTCAGTGCACCAT
Associated Phenotype:
Not determined