Busch Lab

ZMP

srsf1a

Ensembl ID:
ENSDARG00000057691
ZFIN ID:
ZDB-GENE-040426-1950
Description:
Serine/arginine-rich splicing factor 1A [Source:UniProtKB/Swiss-Prot;Acc:Q7SXP4]
Human Orthologue:
SRSF1
Human Description:
serine/arginine-rich splicing factor 1 [Source:HGNC Symbol;Acc:10780]
Mouse Orthologue:
Srsf1
Mouse Description:
serine/arginine-rich splicing factor 1 Gene [Source:MGI Symbol;Acc:MGI:98283]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35834 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22604 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35834
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080413 Essential Splice Site None 257 None 5
ENSDART00000133755 Essential Splice Site None 193 None 4
ENSDART00000135658 None None 117 1 2

The following transcripts of ENSDARG00000057691 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 15095366)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16140329
GRCz11 15 16076351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAAACACGCTCTCGGTGTGCGCGTGCGAGCGGTGCTTCAAACAATAG[T/C]AAGTCTCTTTGTTTTAAATCTAATGTTGGTTGCGGTTTATTTACCGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22604
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080413 Nonsense 233 257 5 5
ENSDART00000133755 None None 193 None 4
ENSDART00000135658 None None 117 None 2

The following transcripts of ENSDARG00000057691 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 15092374)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16137337
GRCz11 15 16073359
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGGAGCCGCAGTCGCAGCAGGAGTCGCAGCCGCAGCAACAACCGTAGC[C/T]GAAGCTACTCTCCACGCCGCAGCCGAGGATCCCCGCAGTACTCGCCACGT
Associated Phenotype:
Not determined