Busch Lab

ZMP

ica

Ensembl ID:
ENSDARG00000057688
ZFIN ID:
ZDB-GENE-030910-4
Description:
islet cell autoantigen 1-like protein [Source:RefSeq peptide;Acc:NP_963881]
Human Orthologue:
ICA1L
Human Description:
islet cell autoantigen 1,69kDa-like [Source:HGNC Symbol;Acc:14442]
Mouse Orthologue:
Ica1l
Mouse Description:
islet cell autoantigen 1-like Gene [Source:MGI Symbol;Acc:MGI:1917625]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12280 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12280
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080408 Nonsense 127 569 6 17
ENSDART00000134429 None None 442 None 11
Genomic Location (Zv9):
Chromosome 6 (position 12802556)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12655778
GRCz11 6 12890636
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGGAGTATGATGGAYGCAACCAGTAAAGCTCTCTGYTGCTCYGCCAAA[C/T]AAAGGCAAGCACTCACACACAAATAGGAAGAAGTTAKGGTTGAAAATCAA
Long Flanking Sequence:
ATTTATCATTTGCAAATAAATAATGATAATGTTTGTTCTGTTTTTCTCTAGTTTTTCCGTTCAGTCCAGAGCACTTGCACAGAACTCCTGAAAGTGATTGAGAAATACCAGCAAAGAATCACACGTAAGAAACATGATCTTCCGGCCTCTTTGTATGCACAAACACAAAGAGTCTCGTTCAGGTCATTCTGAAAGCCACTGCATACAGTTTTCAAGAATACTGCTACTGTTGTGAGAGTCTGATGCAGTTTCAAGCACAACTTTATCAATGTGTTTTTGTGGCTTTTTTTGTCGATAACATTCAAGGCATCTAATGAAGCACTGTTTGTAATGCTGTATGTTATTGGTGTGTTAATAACCGCGGTGACCTTCTTTCTTCAGATCTCTCTCAGGAGGAGAACGAGCTCGGGCTGTTTCTGCGCTTCCAGGCAGAGCATGATAAAACAAAAGCAGGGAGTATGATGGATGCAACCAGTAAAGCTCTCTGCTGCTCCGCCAAA[C/T]AAAGGCAAGCACTCACACACAAATAGGAAGAAGTTAGGGTTGAAAATCAATGCTTGTGATTCGATTTGGTAGTTATTATTTGCAAATGTCAGGATTAGGAGATGGGTCAAGATGTCTGGCTACTCAACTAGTTATCTAACACAGGGGTTCCCAAATTTTTCAGCCCGTGACCCCCAAAATAACAATGCCAGTGACTCACGATCCCCAATATCCTCTGAGGTGGTTATAAATACAGAAACCTTGCATGCAATGACGCAGACACACCAATTAAATTTGTGTCAGTGCTTTAAATGTGCCAGAAAGTATAACCTGATGTTATAAAATCAAAATGCATCTGACGCTATTGCTGCCTTTAATATAATGTAATTACCCAAGGGGTCGCAATTCAATAGAACTAGTAACTATAAGCTACTATAGTAACTATATAGTAACTATAAACGACTATTTTTATTTTCAGTATAGCTATGGATAAAATATGTTAATTCTTATGGTCTAATAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1857
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080408 Nonsense 260 569 9 17
ENSDART00000134429 Nonsense 133 442 3 11
Genomic Location (Zv9):
Chromosome 6 (position 12799229)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12652451
GRCz11 6 12887309
KASP Assay ID:
554-1848.1 (used for ordering genotyping assays)
KASP Sequence:
GAGAAGACTGCACATGTGATGTCTGGCATCCATGAGGCCTTCAAAGGATA[T/A]GTACCCTACCAGTTCACTACCCTTAAAGTGAGTGTCARTATATACAGTTG
Long Flanking Sequence:
AGAGCCATTGCTGACAGCCTCCTGACAGTGAGCCGGATGGAGAAAGCTCGAACCGAATACCGCGCTGCACTGCTCTGGATGAAAGCCTCCTCACAGGAGCTGGACCCAGATACTTACAAACAACTGGAGAAATTTCGCATGGTGAGATCGTGCAAAATGAGCAACGGTATGACTTGCATCAACATACGGGAAAGTGTTCTGCAATCTGTGTGTTTGTGAACAGGTTCAGGCTCAGGTAAGAGAAACAAAAGTGTGTTTCGATAAGCTCAAGAATGACGTTTGTCAGAAAGTGGACATGCTGGGAGCCAGTCGCTGCAACATGCTGTCACATTCCTTATGCACTTACCAGGTAACACTTATTTCCTTTCACCTTAAATGGCTTGGCTTTTACTTTAGTTTTCATTTTGTGGTGTTGTTGGTGTTGTGTAGACGACGCTCCTACAGTACTGGGAGAAGACTGCACATGTGATGTCTGGCATCCATGAGGCCTTCAAAGGATA[T/A]GTACCCTACCAGTTCACTACCCTTAAAGTGAGTGTCAGTATATACAGTTGACGACAATTTTTCACCCTCCTGTGATTGTTTTTGTCCTTATCAAATATTTTCCAAATGATGTTTAATAGAGCAAGACATTTTCAAAGTATTTCCTAAAATATTTGTTCTTCTGGAGAAAGTCCTATTTGTTTTATTTTGGCTAATATAAAAGCTGTTTTTAATTTTTTTTAATCATTTTAAGATTAAAATTATTATTAACTATTTTTTTCAATTGTCTACAGAACAAATCATTATTATACAATAATTTGCCTAATTACCCCAACCTAACCTAATTAACCTAGTTAAGCCTTTAAATTGCACTCTTAAGATGAATATCTTGAAAAATATCTAGTAAAATGTTATCCAGCAGGGCTAAAAATTCTGACATCAACTGTAAATGTCAGCCAGTAAACTGCTGTAATGTGATCTGACCCCTCATTCATCTATATGGCAGGAACTGAGAGACCCGC
Associated Phenotype:
Not determined