Busch Lab

ZMP

si:dkey-38o19.8

Ensembl ID:
ENSDARG00000057680
ZFIN ID:
ZDB-GENE-100922-240
Human Orthologues:
FOXJ2, FOXJ3
Human Descriptions:
forkhead box J2 [Source:HGNC Symbol;Acc:24818]
forkhead box J3 [Source:HGNC Symbol;Acc:29178]
Mouse Orthologues:
Foxj2, Foxj3
Mouse Descriptions:
forkhead box J2 Gene [Source:MGI Symbol;Acc:MGI:1926805]
forkhead box J3 Gene [Source:MGI Symbol;Acc:MGI:2443432]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39083 Nonsense Mutation detected in F1 DNA Not yet available
sa32077 Essential Splice Site Available for shipment Available now
sa22778 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28600
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080396 Essential Splice Site 103 516 2 9
ENSDART00000139916 Essential Splice Site 103 448 3 8
Genomic Location (Zv9):
Chromosome 16 (position 14530575)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12889034
GRCz11 16 12779154
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGTAGATACAAATAGACGCATATGTTTTTTTTTTTTTTTGTTCTCTTA[G/A]AACTCAATTCGCCACAATTTGTCCCTCAATAAATGTTTCCGGAAAGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39083
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080396 Nonsense 168 516 4 9
ENSDART00000139916 Nonsense 168 448 5 8
Genomic Location (Zv9):
Chromosome 16 (position 14528112)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12886571
GRCz11 16 12776691
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATACTTTTGTTTCAGACTCCTTTCCCAGAGACACAACTGCCTGCCAAT[C/T]AACCGGAGCCCCTCCCCCCTCAGCCAGACACCAAGAGCACATTCCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32077
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080396 Essential Splice Site 240 516 5 9
ENSDART00000139916 Essential Splice Site 240 448 6 8
Genomic Location (Zv9):
Chromosome 16 (position 14524807)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12883266
GRCz11 16 12773386
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTTCAGTCGCTCTGTCGCTCCATGAGAGAGAAGGTCACTTCCCAATG[T/C]AAGTAAAACTGCTTTTTCATTTAAGCTCATTAATTAAGATTCACAATTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7782
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080396 Nonsense 386 516 8 9
ENSDART00000139916 Nonsense 352 448 8 8
Genomic Location (Zv9):
Chromosome 16 (position 14515806)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12874265
GRCz11 16 12764385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGCGAGATTGGGCTCTGGATCCAGCACTCTTCACYTCGCTCTGTGATT[C/A]GCTCAACCGTTTCTTCACTCACAAGGGTCTCATTGGCTCGTCKTCTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22778
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080396 Essential Splice Site 483 516 None 9
ENSDART00000139916 None 449 448 None 8
Genomic Location (Zv9):
Chromosome 16 (position 14515514)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12873973
GRCz11 16 12764093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCCAGGGGGACTGCAGCCCACCACCAGCCAGCCCATGACTCCCAACGG[T/G]ATGTCCAGAGATCACTTACATCCATATAGGAACAGTGCATATTTAGACTA
Associated Phenotype:
Not determined